Online Tools To Design Master Bathroom 10'5 W 11.4l

Cancer Cell. Author manuscript; available in PMC 2020 Dec 9.

Published in final edited form as:

PMCID: PMC7227117

NIHMSID: NIHMS1545811

A Menin-MLL inhibitor induces specific chromatin changes and eradicates disease in models of MLL-rearranged leukemia

Andrei V. Krivtsov,¹ Kathryn Evans,² Jayant Y. Gadrey,¹ Benjamin K. Eschle,¹ Charlie Hatton,¹ Hannah J. Uckelmann,¹ Kenneth N. Ross,¹ Florian Perner,¹ Sarah N. Olsen,¹ Tara Pritchard,² Lisa McDermott,² Connor D. Jones,² Duohui Jing,² Ali Braytee,^{3, 4} Diego Chacon,^{3, 4} Eric Earley,⁵ Brian M. McKeever,⁶ David Claremon,⁷ Andrew J. Gifford,^{2, 8} Heather J. Lee,⁹ Beverly A. Teicher,¹⁰ John E. Pimanda,^{3, 11} Dominik Beck,^{3, 4} Jennifer A. Perry,¹ Malcolm A. Smith,¹⁰ Gerard M. McGeehan,¹² Richard B. Lock,^{2, 13} and Scott A. Armstrong^{1, 13, 14}

Andrei V. Krivtsov

¹Department of Pediatric Oncology, Dana-Farber Cancer Institute, and Division of Hematology/Oncology, Boston Children's Hospital, Boston, MA, 02215, USA

Kathryn Evans

²Children's Cancer Institute, School of Women's and Children's Health, Sydney, UNSW 2052, Australia

Jayant Y. Gadrey

¹Department of Pediatric Oncology, Dana-Farber Cancer Institute, and Division of Hematology/Oncology, Boston Children's Hospital, Boston, MA, 02215, USA

Benjamin K. Eschle

¹Department of Pediatric Oncology, Dana-Farber Cancer Institute, and Division of Hematology/Oncology, Boston Children's Hospital, Boston, MA, 02215, USA

Charlie Hatton

¹Department of Pediatric Oncology, Dana-Farber Cancer Institute, and Division of Hematology/Oncology, Boston Children's Hospital, Boston, MA, 02215, USA

Hannah J. Uckelmann

¹Department of Pediatric Oncology, Dana-Farber Cancer Institute, and Division of Hematology/Oncology, Boston Children's Hospital, Boston, MA, 02215, USA

Kenneth N. Ross

¹Department of Pediatric Oncology, Dana-Farber Cancer Institute, and Division of Hematology/Oncology, Boston Children's Hospital, Boston, MA, 02215, USA

Florian Perner

¹Department of Pediatric Oncology, Dana-Farber Cancer Institute, and Division of Hematology/Oncology, Boston Children's Hospital, Boston, MA, 02215, USA

Sarah N. Olsen

¹Department of Pediatric Oncology, Dana-Farber Cancer Institute, and Division of Hematology/Oncology, Boston Children's Hospital, Boston, MA, 02215, USA

Tara Pritchard

²Children's Cancer Institute, School of Women's and Children's Health, Sydney, UNSW 2052, Australia

Lisa McDermott

²Children's Cancer Institute, School of Women's and Children's Health, Sydney, UNSW 2052, Australia

Connor D. Jones

²Children's Cancer Institute, School of Women's and Children's Health, Sydney, UNSW 2052, Australia

Duohui Jing

²Children's Cancer Institute, School of Women's and Children's Health, Sydney, UNSW 2052, Australia

Ali Braytee

³Lowy Cancer Research Centre and the Prince of Wales Clinical School, Sydney, UNSW 2052, Australia

⁴Centre for Health Technologies and the School of Biomedical Engineering, University of Technology Sydney, Ultimo, NSW 2007, Australia

Diego Chacon

³Lowy Cancer Research Centre and the Prince of Wales Clinical School, Sydney, UNSW 2052, Australia

⁴Centre for Health Technologies and the School of Biomedical Engineering, University of Technology Sydney, Ultimo, NSW 2007, Australia

Eric Earley

⁵RTI International, Research Triangle Park, NC, 27709, USA

Brian M. McKeever

⁶Brian Michael McKeever, LLC, Lake Ronkonkoma, NY, 11779

David Claremon

⁷CGM Pharma, LLC, Fort Washington, PA, 19034, USA

Andrew J. Gifford

²Children's Cancer Institute, School of Women's and Children's Health, Sydney, UNSW 2052, Australia

⁸Department of Anatomical Pathology, Prince of Wales Hospital, Sydney, NSW 2031, Australia

Heather J. Lee

⁹School of Biomedical Sciences and Pharmacy, Faculty of Health and Medicine, The University of Newcastle, Callaghan, NSW 2308, Australia

Beverly A. Teicher

¹⁰National Cancer Institute, Bethesda, MD, 20892, USA

John E. Pimanda

³Lowy Cancer Research Centre and the Prince of Wales Clinical School, Sydney, UNSW 2052, Australia

¹¹Department of Haematology, Prince of Wales Hospital, Sydney, NSW 2210, Australia

Dominik Beck

³Lowy Cancer Research Centre and the Prince of Wales Clinical School, Sydney, UNSW 2052, Australia

⁴Centre for Health Technologies and the School of Biomedical Engineering, University of Technology Sydney, Ultimo, NSW 2007, Australia

Jennifer A. Perry

¹Department of Pediatric Oncology, Dana-Farber Cancer Institute, and Division of Hematology/Oncology, Boston Children's Hospital, Boston, MA, 02215, USA

Malcolm A. Smith

¹⁰National Cancer Institute, Bethesda, MD, 20892, USA

Gerard M. McGeehan

¹²Syndax Pharmaceuticals, Waltham, MA, 02451, USA

Richard B. Lock

²Children's Cancer Institute, School of Women's and Children's Health, Sydney, UNSW 2052, Australia

¹³These authors contributed equally

Scott A. Armstrong

¹Department of Pediatric Oncology, Dana-Farber Cancer Institute, and Division of Hematology/Oncology, Boston Children's Hospital, Boston, MA, 02215, USA

¹³These authors contributed equally

¹⁴Lead Contact

The publisher's final edited version of this article is available at Cancer Cell

See other articles in PMC that cite the published article.

Supplementary Materials

1.

GUID: D4277CF6-EE27-4A6B-89C8-8342DB646EBB

2: Table S1 related to Figures 2 and S2. List of genes that significantly change expression >2-fold in MOLM13 or RS4;11 cells upon 2- or 7-day treatment with VTP-50469 or after 6 days of MEN1 knockout.

GUID: 4EB8B6CE-9EF3-4B7E-ADCC-E670719BB610

3: Table S2 related to Figures 3 and S3. Gene occupancy of Menin, MLL1n, DOT1L or H3K79me2 in ML-2, MOLM13, RS4;11 cells and MOLM13 cells with MEN1 knock out.

GUID: BEECF247-3C33-433D-92FA-E3602E4236FE

4: Table S3, related to Figures 4 and ​ 5. PDX samples that were used in the study.

GUID: 689A7983-93EF-413A-BC89-0DEB07220599

5: Table S4, related to Figure 7. List of genes that lose occupancy >2-fold of MLL1 and Menin in one of MOLM13, RS4;11 and ML-2 cells.

GUID: 55AF35F0-4822-4EEC-B679-F2F8C8C350B9

6: Table S5, related to STAR Methods. Lists of genes in the gene sets used for GSEA.

GUID: B4850EBD-826E-4810-8389-5DACB129C23E

Data Availability Statement

The co-crystal structure of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 and Menin-MLL has been deposited to RCSB, PDB ID: 6PKC. RNA-, CUT&RUN- and ChIP-seq data from this paper has been deposited in in NCBI GEO: {"type":"entrez-geo","attrs":{"text":"GSE127508","term_id":"127508"}}GSE127508. Data from single cell sequencing of full-length transcripts (scRNA-seq) from this paper has been deposited in in NCBI GEO: {"type":"entrez-geo","attrs":{"text":"GSE127298","term_id":"127298"}}GSE127298.

SUMMARY

Inhibition of the Menin (MEN1) and MLL (MLL1, KMT2A) interaction is a potential therapeutic strategy for MLL-rearranged (MLL-r) leukemia. Structure-based design yielded the potent, highly selective and orally-bioavailable small molecule inhibitor {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469. Cell lines carrying MLL-rearrangements were selectively responsive to {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469. {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 displaced Menin from protein complexes and inhibited chromatin occupancy of MLL at select genes. Loss of MLL binding led to changes in gene expression, differentiation, and apoptosis. Patient-derived xenograft (PDX) models derived from patients with either MLL-r AML or MLL-r ALL showed dramatic reductions of leukemia burden when treated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469. Multiple mice engrafted with MLL-r ALL remained disease free greater than one year after treatment. These data support rapid translation of this approach to clinical trials.

In Brief

Krivtsov et al. develop a selective and orally bioavailable small molecule inhibitor targeting the Menin-MLL interaction, which suppresses a subset of MLL-fusion target genes and significantly improves survival in PDX models of MLL-rearranged leukemia.

INTRODUCTION

Chromosomal translocations involving the MLL gene at chromosome 11q23 give rise to aggressive leukemias and are present in approximately 10% of human acute leukemias (Charles and Boyer, 2017; Marschalek, 2015). MLL-r leukemias are a distinct subset of acute myeloid (AML) and lymphoblastic leukemias (ALL) that are found in both children and adults and are particularly common in infants less than one year of age. MLL-rearrangements predict a poor prognosis particularly when they are identified in infants with ALL (Krivtsov and Armstrong, 2007). There remains a significant unment need for more effective, less toxic therapies.

MLL-rearrangements produce a chimeric gene that encodes an oncogenic fusion-protein that consists of the N-terminus of MLL fused to the C-terminus of one of over 80 known fusion partners (Meyer et al., 2018). MLL-fusion proteins bind to DNA/chromatin and induce leukemic transformation in hematopoietic stem and progenitor cells through transcriptional deregulation of fusion protein target genes. The best studied of the target genes include HOXA genes and their co-factors MEIS1 and PBX3 which have been shown to be important for leukemia development, cell proliferation and self-renewal. Other critical members of the MLL-fusion driven gene expression program include CDK6 and MEF2C, among others (Brown et al., 2018; Guo et al., 2017; Krivtsov et al., 2017; Kumar et al., 2009; Placke et al., 2014). Much work has focused on the mechanisms required to maintain this leukemogenic gene expression program with the hope that this information would lead to new therapeutic approaches.

A major mechanism by which MLL-fusion proteins maintain leukemogenic gene expression is through interaction with chromatin-associated protein complexes. Critical proteins found in these complexes include Menin, Disruptor of Telomeric Silencing 1 Like (DOT1L), and members of the Super Elongation Complex (SEC). In particular, the mechanisms by which Menin and DOT1L promote MLL-fusion protein driven gene expression have been heavily studied (Dafflon et al., 2017). MLL-r leukemias are critically dependent upon the histone H3 lysine 79 (H3K79) methyltransferase DOT1L and some recruit DOT1L to chromatin, leading to aberrant methylation of H3K79 at MLL-fusion target genes (Bitoun et al., 2007; Guenther et al., 2008; Krivtsov et al., 2008; Milne et al., 2005; Okada et al., 2005). This results in inappropriately enhanced expression of genes critical for hematopoietic cell proliferation, including HOXA genes and MEIS1 (Armstrong et al., 2002; Krivtsov and Armstrong, 2007). Similarly, Menin has been shown to be critical for maintenance of MLL-fusion driven gene expression (Yokoyama et al., 2005). Menin binds to the MLL portion of the fusion protein via a 5 amino acid sequence near the N-terminus of MLL and this interaction is critical for MLL-fusion mediated transformation (Yokoyama and Cleary, 2008).

Small molecule inhibition of the interaction between Menin with MLL-fusion proteins has been shown to be a potential therapeutic strategy for the treatment of MLL-r leukemias (Grembecka et al., 2012; Xu et al., 2016). However, more potent and selective small molecule inhibitors are critical for in vivo studies particularly for MLL-r ALL. Therefore, we developed new Menin-MLL interaction inhibitors that have greater potency and improved pharmaceutical properties than those that are currently available using a structurally optimized chemical design. {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 represents a potent and selective inhibitor of the Menin-MLL interaction, which shows remarkable preclinical efficacy against in vivo models of MLL-r acute leukemia.

RESULTS

Discovery of a unique, potent, and specific Menin-MLL inhibitor

{"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 is a small molecule inhibitor of the Menin-MLL protein-protein interaction that was developed using iterative structure-based drug design guided by Contour™ (Liu et al., 2012) and X-ray co-crystallography. Initial designs started with the piperazinyl pyrimidine fragment (Figure 1A) bound in the MLL binding pocket on Menin, using a pose adapted from X-ray data of MI-2 analogs (MGQ4) (Shi et al., 2012). To improve potency and drug-likeness, the key optimization goals were to: maintain optimum distance and geometry for the pyrimidine H-bond to Tyr²⁷⁶; productively fill a hydrophobic pocket (Phe²³⁸) by branching from the pyrimidine ring; extend across the MLL binding pocket to incorporate an anchoring distal H-bond; and introduce a basic protonated amine which exploits a pi-cation interaction in the bridging structure and also improves aqueous solubility (Figure 1A). Appending a 4-fluorophenyl aniline to the pyrimidine ring of compound 1 led to compound 2, a Menin-MLL binding inhibitor with a Ki=97 nM. Further elaboration of the 4-fluorophenyl with a hydrophobic side chain and replacement of the piperazine with a spirocyclic moiety gave compound 3 which exhibited a ~30-fold increase in potency (Ki=2.9 nM). A co-crystal structure showed that the tertiary amine of compound 3 established a distinct pi-cation interaction mediated by Tyr³¹⁹ and Tyr³²³. This Menin-MLL inhibitor, however, suffered from off-target activity, cytochrome P450 liabilities and poor PK. Fortunately, this molecular framework was amenable to optimization to address these deficiencies. Replacement of the phenyl ring in compound 3 by substituted amides kept key hydrophobic interactions, improved physical properties and avoided multiple off-target activities. Optimization of the spirocyclic linker and addition of the cyclohexyl sulfonamide generated compound 4, {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469, that bridged the MLL binding pocket to establish a H-bond with Trp³⁴¹ (Figure 1A). The 1.90A co-crystal structure shows {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 bound in the Menin-MLL binding pocket and its key binding features, including the anchoring H-bonds (Y276 and W341) and the pi-cation interacting Y319 and W323 side chains (6PKC, Figure 1B).

Development of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469

(A) Molecules 1 through 4 in medicinal chemistry development of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469. Dotted lines indicate {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 potential interactions with Y276 and W341 of Menin.

(B) Crystal structure of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 bound in Menin pocket.

(C) Table summarizing {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 IC₅₀ concentrations in MLL-r and control cell lines obtained in cell proliferation experiments. IC₅₀ mean +/− SD.

(D) Western blot analysis of size fractionated nuclear lysates from DMSO or {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treated MOLM13 cells with Menin anitbody.

First, we assessed the inhibitory effect of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 on proliferation of MLL-r cell lines using several methods: live cell counts, CellTiter-Glo or MTT assay. MLL-r AML (MOLM13, THP1, NOMO1, ML2, EOL1, murine MLL-AF9) and ALL (KOPN8, HB11;19, MV4;11, SEMK2, and RS4;11) cell lines were grown with limiting dilutions of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 or DMSO. Exposure to {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 led to a profound reduction in cell proliferation in a concentration-dependent manner in MLL-r cell lines carrying but not in those with WT MLL (HL-60, REH, K562, murine MOZ-TIF2) (Figure 1C, S1A). We compared the response of MOLM13 (MLL-AF9) and RS4;11 (MLL-AF4) cell lines to {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 with a previously described Menin-MLL inhibitor, MI-503 (Borkin et al., 2015), and DOT1L inhibitor, EPZ5676 (Daigle et al., 2013). {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 more potently inhibited cell growth as compared to both MI-503 and EPZ5676 (Figure S1B). Moreover, cell proliferation was inhibited more rapidly by {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 than EPZ5676 (Figure S1C). At early timepoints MLL-r B-ALL cell lines, but not MLL-r AML cell lines, underwent apoptosis in response to {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 in a dose-dependent manner (Figure S1D–E). MLL-r AML cell lines underwent dose-dependent differentiation starting at 4-6 days of exposure to {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 as demonstrated by an increase in CD11b cell surface expression (Figure S1F). The more rapid response of B-ALL over AML cell lines did not correlate with cellular levels of Menin protein (Figure S1G). These experiments show that {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 has potent antiproliferative activity against cells carrying MLL-rearrangements with an IC₅₀ in the low nM range.

Since disruption of the Menin-MLL interaction might lead to loss of Menin from high molecule weight complexes, we assessed whether {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 had such biochemical effects in cells. We treated MOLM13, RS4;11 and ML2 cells with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 or DMSO for 3 days, extracted nuclei, and weight-fractionated nuclear complexes using glycerol gradient ultracentrifugation (Figure S1H). With {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment most of the Menin was detected in the early free-protein fractions whereas in DMSO-treated cells Menin was also found in fractions that correspond to high molecular weight complexes in MOLM13 cells, RS4;11 and ML2 cells (Figure 1D, S1I–J). These experiments demonstrate that treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 efficiently disrupts Menin incorporation into high molecular weight complexes and thus has appropriate biochemical activity in cells.

{"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment rapidly suppresses MLL-fusion target gene expression

Previous studies have shown that inhibition of the Menin-MLL interaction leads to down-regulation of HOXA, MEIS1 and other MLL-fusion target genes in MLL-r leukemia cells (Borkin et al., 2015; Yokoyama et al., 2005). In order to assess early and delayed gene expression changes, MOLM13 and RS4;11 cells were treated for 2 and 7 days with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 or DMSO followed by RNA-seq analysis. In MOLM13 cells, expression of 153 and 160 genes showed a >2-fold decrease (p<0.05) at days 2 and 7, respectively (Figure 2A–B, Table S1). Similarly, in RS4;11 cells, 61 and 475 genes decreased expression >2-fold at 2 and 7 days, respectively (Figure S2A–B). Many of the genes that decreased in expression were well-defined MLL-fusion target genes include MEIS1, MEF2C, JMJD1C and PBX3, all of which have previously shown to be critical for MLL-r leukemia proliferation (Bernt et al., 2011; Guenther et al., 2008; Kumar et al., 2009; Zhu et al., 2016). While HOXA genes did decrease in expression after treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469, these changes were much less pronounced and did not reach significance (Figure 2A–B, S2A–B, Table S1). Next, we used GSEA to determine the extent to which MLL-fusion target genes changed expression at days 2 and 7. MLL-AF9 and MLL-AF4 target gene expression decreased significantly in MOLM13 and RS4;11 cells, respectively, by day 2 and to an even greater extent by day 7 (Figure 2C, S2C). {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment also suppressed expression of a set of genes that were suppressed by MI-389, a previously reported Menin-MLL interaction inhibitor (Borkin et al., 2015) (Figure 2D, S2D). Therefore, {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment leads to rapid downregulation of MLL-fusion driven gene expression, however genes such as MEIS1, PBX3, and MEF2C are more responsive to treatment than HOXA genes.

Gene Expression Changes Induced by {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469

(A) Volcano-plot of RNA-seq data obtained from MOLM13 cells treated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469. Selected MLL-fusion target genes are labeled.

(B) Heat map of top 20 most suppressed genes after 2- and 7-day {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment in MOLM13 cells. MLL-fusion target genes are in red.

(C-E) GSEA of gene expression changes in MOLM13 cells treated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 compared to (C) 113 MLL-AF9 target genes; (D) 198 genes suppressed by MI-389 in MV4;11 cells; (E) 96 genes suppressed by treatment with EPZ5676 in MOLM13 cells.

(F) DMSO-normalized relative expression of 17 genes that lose expression >3-fold after 7 days EPZ5676 (1 μM) or {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 (330 nM) treatment in MOLM13 cells. The table shows gene expression changes at 2 and 7 days.

(G) PCA clustering of gene expression in MOLM13 cells after 2 or 7 days of treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 or EPZ5676.

(H) Volcano-plot of RNA-seq data obtained from MOLM13-Cas9 cells infected with MEN1 or control sgRNA at day 6. Selected MLL-fusion targets genes are labeled.

(I) Venn diagram depicting the overlap of genes that are suppressed >2-fold by either {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment (7 days) or MEN1 knock-out (6 days).

Either inhibition of the Menin-MLL fusion interaction or inhibition of DOT1L enzymatic activity leads to down-regulation of MLL-fusion protein driven gene expression (Dafflon et al., 2017; Kuhn et al., 2016; Okuda et al., 2017). Having detected changes in gene expression in response to {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment, we wanted to compare changes in gene expression and the kinetics of gene expression changes in response to {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 with the DOT1L inhibitor EPZ5676 (Daigle et al., 2013). {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment of MOLM13 and RS4;11 cells resulted in significant suppression of DOT1L dependent genes (Figure 2E, S2E). Next, we compared the kinetics of gene expression changes induced by EPZ5676 and {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469. Treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 produced clear suppression of relevant genes in MOLM13 and RS4;11 cells by day 2. However, treatment with EPZ5676 did not suppress expression of the same target genes by day 2, but did induce suppression by day 7 (Figure 2F, S2F). We also assessed global changes in gene expression by PCA and again found a more rapid change in gene expression induced by {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 compared to EPZ5676 (Figure 2G). Therefore, inhibition of the Menin-MLL interaction leads to changes in MLL-fusion driven gene expression that are similar to, but much more rapid than, inhibition of DOT1L enzymatic activity.

To further confirm that {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 acts through disruption of Menin, we tested whether genetic inactivation of MEN1 phenocopies the changes in gene expression seen with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469. MOLM13 cells expressing Cas9 were infected with MEN1 or control sgRNAs (Doench et al., 2014). Six days post-infection, the cells were collected and prepared for RNA-seq analysis. We detected 69 genes that lost expression >2-fold, including MLL-AF9 target genes such as HOXA3, WNK1, MEIS1, JMJD1C, CNOT6L, REEP3, and SMC4 (p<0.05) (Figure 2H, Table S1). Expression of these 69 genes was significantly suppressed upon {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment at day 7 in MOLM13 cells (Figure S2G). Moreover, comparison of genes suppressed by {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 with genes downregulated by CRISPR-mediated knock-out of MEN1 resulted in an overlap of 34 genes, p=8.9x10⁻⁵⁰ (Figure 2I). Thus, genetic loss of MEN1 and treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 result in the reduction of expression of a highly significantly overlapping group of genes. While future studies will continue to refine the {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 target profile, we conclude that Menin inhibition mediates a major portion of the cellular effects of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469.

{"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 induces global changes in Menin and selective changes in MLL chromatin occupancy

Since {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment led to disruption of Menin-associated protein complexes and MLL-fusion driven gene expression, we next assessed chromatin occupancy of Menin and other chromatin-associated proteins and histone modifications important in MLL-r leukemia, including DOT1L, MLL/MLL-fusions and methylation of H3K79 (H3K79me2). We used ChIP-seq to assess genomic binding sites, as well as the dynamics of Menin, MLL/MLL-fusions and DOT1L interactions with chromatin upon {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment (3 days) in MOLM13, RS4;11 and ML2 cells. Analysis of Menin binding confirms that {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment leads to global loss of Menin binding to chromatin (Figures 3A–C, S3A–C, Table S2). Likewise, the sites and magnitude of Menin loss across the genome were similar between MOLM13, RS4;11 and ML2 cells (Figure S3D). We also detected a reduction, but not total loss, of DOT1L occupancy after {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment in MOLM13, RS4;11 and ML2 cells. However, we see near complete loss of DOT1L binding at many MLL-AF9 target genes (Figure 3B–C, S3B–C), while many other genes including HOXA genes, MYB and GAPDH, retain some DOT1L (Figure 3C, S3C). Interestingly, we did not observe detectable loss in global H3K79me2 levels by ChIP-seq (Figure 3A, S3A). However, H3K79me2 levels are drastically reduced at genes including MEF2C, MEIS1 and JMJD1C (Figure 3C, S3C). As these results were somewhat surprising, we confirmed that methylation levels of H3K79 remained constant at the protein level over 9 days of treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 while inhibition of DOT1L led to a marked decrease in H3K79me2 (Figure S3E–F). We also consistently detected a decrease in DOT1L and Menin protein levels with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment (Figure S3E), which is consistent with our ChIP-seq results.

{"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 Remodels MLL-Fusion Chromatin-Associated Complexes

(A-B) Menin, MLL1n, DOT1L, and H3K79me2 ChIP-seq data in MOLM13 cells treated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 or DMSO were plotted as (A) heat-map/tornado plots of TSS±3kb, (B) average/meta-plots of 113 MLL-AF9 targets TSS±3kb.

(C) Gene tracks of Menin, MLL1n, DOT1L and H3K79me2 ChIP-seq signals (RPM) at selected MLL-AF9 target genes in MOLM13 cells treated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469.

(D) Gene tracks of MLL1n CUT&RUN signal on selected MLL-AF9 target genes in control (CTRL) and MEN1 knock-out MOLM13 cells.

(E) Venn diagram depicting the overlap in genes that lose MLL1n occupancy (>2-fold) after {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment or CRISPR deletion of MEN1.

(F) Scatter plot depicting correlation of MLL1n and Menin gene occupancy after {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment in MOLM13 cells. {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469/DMSO ratios shown as log10 values. Gene expression levels are indicated in the heatmap.

(G) Scatter plot depicting correlation of MLL1n and DOT1L gene occupancy after 3-day treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 in MOLM13 cells. {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469/DMSO ratios shown as log10 values. H3K79me2 levels at genes are indicated in the heatmap.

(H) GSEA of gene expression changes in MOLM13 cells treated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 for 7 days compared to genes that lose Menin, MLL1n, or DOT1L chromatin occupancy.

Remarkably, treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 did not globally displace MLL1 from chromatin in MOLM13, RS4;11 and ML2 cells (Figure 3A–C, S3A–C). Of note, the antibody used for MLL ChIP-seq recognizes the N-terminus of MLL (MLL1n) and thus recognizes both wildtype MLL1 and MLL-fusion proteins. To control for this, we included ML2 cells in our experiment as these cells express an MLL-AF6 fusion protein but have lost the remaining WT MLL1 allele (Ohyashiki et al., 1986; Wang et al., 2011). Thus, all signal in ML2 cells comes from the fusion. Direct comparison of the sites and magnitude of MLL1n loss across the genome were similar between MOLM13, RS4;11 and ML2 cells (Figure S3G). When we evaluated MLL1n occupancy at specific MLL-fusion target loci, we consistently found a >2-fold loss of the MLL1n signal at the MEIS1, MEF2C and JMJD1C loci, whereas other MLL-fusion target genes, such as HOXA genes and MYB, did not lose MLL1n occupancy in either MOLM13 or RS4;11 cell lines (Figure 3C, S3C). Given that MLL1n occupancy is not lost at HOXA genes after treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469, we wanted to assess how genetic deletion of MEN1 affects MLL1/MLL-AF9 chromatin occupancy. We again used MOLM13 cells expressing Cas9 to delete MEN1, resulting in loss of Menin protein (Figure S3H). Six days post-infection we analyzed cells by CUT&RUN-seq, a method that is more effective than ChIP-seq when cell number is limiting (Skene and Henikoff, 2017). Analysis of the data identified 39 genes that lose >2-fold occupancy by MLL1n, 20 of which were the same that lose MLL1n occupancy after {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment including dramatic loss at MEF2C, MEIS1, and JMJD1C but not other loci such as HOXA, MYB, or GAPDH (Figure 3D–E). Together, the data suggest that only a subset of MLL-target genes are sensitive to inhibition of Menin by either genetic deletion or pharmacologic perturbation.

The recognition that {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 removed MLL1/MLL-fusions from chromatin at specific loci, prompted a more global comparison of changes in MLL, DOT1L and Menin occupancy and gene expression changes. We found that there were a select group of genes that lost both MLL and Menin occupancy upon {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment in MOLM13 and in RS4;11 cells. These genes included MLL-target genes that also lose expression upon {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment (Figure 3F, S3I). There was a similar strong correlation between genes that lost MLL and DOT1L occupancy which results in >2-fold loss of H3K79me2 with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment (Figure 3G, S3J). Furthermore, we observed that genes with the highest level of occupancy by Menin or DOT1L lost the highest proportion of MLL1n after {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment (Figure S3K–M). Finally, GSEA showed that there was an impressive association between loss of Menin, MLL1n, or DOT1L on chromatin and changes in gene expression (Figure 3H, S3N). In sum, while loss of Menin on chromatin does not lead to a global loss of MLL chromatin binding, it does lead to loss of MLL binding, DOT1L binding, H3K79me2 and the concordant gene expression decreases at a specific subset of MLL-fusion target genes (e.g. MEF2C, MEIS1, JMJD1C) whereas another set (e.g. HOXA, MYB) is much less sensitive to Menin-MLL perturbation.

{"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment can eradicate disease in PDX models of MLL-r acute leukemia

We sought to investigate the therapeutic potential of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 in vivo. Initially, we assessed {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment on leukemia burden using an MV4;11 xenotransplantation model of systemic disease. Treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 was highly efficacious across all dosage levels (15, 30 and 60 mg/kg, BID) and all treatment groups had a significant survival advantage over the control group (Figure 4A). Mice dosed at 30 and 60 mg/kg {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 had a surprisingly extended survival advantage, indicating the potential for efficacy in PDX models.

Establishing an Effective {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 Dose In Vivo

(A) Kaplan-Meyer survival curves of NSG mice engrafted with MV4;11 cells and dosed with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 as indicated. Green bar indicates the 28-day treatment period (n = 10).

(B) PK/PD assessment of MEIS1 expression in MV4;11 cells engrafted in nude rats compared to {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 plasma concentration after dosing using implanted micropumps.

(C) %hCD45⁺ cells in the peripheral blood (PB) of NSG mice transplanted with MLL-r AML PDX (68552 or 40315) on either control or 0.1% {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 mouse chow. Bars represent SD.

(D, G) %hCD45⁺ cells in the bone marrow (BM) and spleens (SP) of mice dosed for 28 days with 0.1% {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 chow or control diet. Bars = median, t-test was used to calculate p-value.

(E, H) Spleen weights from PDX mice dosed in (D). Bars = median, t-test was used to calculate p-value.

(F, I) FACS assessment of CD11b surface expression in BM isolated from PDX mice dosed as in (D) Bars represent the median, t-test was used to calculate p-value.

In preparation for PDX studies, we sought to better understand the in vivo exposure/response relationship for {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469. Therefore, a pharmacokinetic/pharmacodynamic (PK/PD) method was developed to determine the plasma IC₅₀ using subcutaneous MV4;11 tumors in nude rats. After tumors reached approximately 250 mm³, rats received either vehicle or {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 (1.2, 6.0, 30 mg/kg) for 4 days. Dosing with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 produced a dose-dependent decrease in the size of the subcutaneous tumors over 4 days of treatment (Figure S4A). Also, MEIS1 transcript levels were suppressed and inversely correlated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 plasma concentration, yielding a plasma IC₅₀ of 109 ± 15 nM (Figure 4B). This in vivo plasma IC₅₀ differs from the in vitro IC₅₀s calculated in Figure 1C as it reflects inhibitory activity that integrates all aspects of protein binding and partitioning into cells/tissues.

Previous experiments demonstrated that phenotypic changes in leukemia require >90% suppression of MEIS1 transcription (Kumar et al., 2009; Orlovsky et al., 2011). Based on our PK/PD correlation data we estimated that a {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 plasma concentration of ~1 μM would be required to suppress MEIS1 transcription >90%, which would require daily dosing at >100 mg/kg. Given the chemical stability and oral bioavailability, we prepared mouse chow formulated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 at 0.0125%, 0.025%, 0.05%, 0.1% (weight/weight) to assess which concentration would provide the required plasma concentration of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 for in vivo dosing. The results showed that the plasma concentration of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 ranged from 700-2000 nM over 24 hours in mice fed with 0.1% {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 formulated chow (Figure S4B). Thus, chow formulated with 0.1% {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469, which delivers ~120-180 mg/kg/day, was chosen for further in vivo studies.

We next tested the efficacy of delivery of {"type":"entrez-protein","attrs":{"text":"VTP54069","term_id":"1773244844"}}VTP54069 in mouse chow in a well-established bone marrow (BM) transplantation model of murine MLL-AF9 AML. Mice were injected with primary MLL-AF9 GFP leukemia to generate secondary leukemias. Engrafted mice were fed 0.1% {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 or control formulated chow for 40 days and sacrificed after 68 days. GFP expression was monitored in the peripheral blood (PB) throughout the experiment (Figure S4C) and in the BM and spleen post-mortem (Figure S4D). In a separate experiment {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment significantly prolonged survival of mice transplanted with MLL-AF9 leukemia (Figure S4E). Treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 chow eradicated mouse MLL-AF9 AML cells in all tested tissues, thus confirming that {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 is efficacious at eliminating murine MLL-AF9-driven AML and stable in mouse chow for an extended period of time.

Next, we assessed the activity of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 against two MLL-r and a WT MLL AML (IHD2^R132H ) PDXs (Table S3) in mice fed 0.1% {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 formulated chow. Mice engrafted with MLL-r AML PDXs and treated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 demonstrated a significant reduction of human CD45⁺ (hCD45⁺) cells in the PB compared with mice fed control chow (Figure 4C). Moreover, the remaining human cells in the PB of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treated mice had elevated cell surface CD11b expression indicating differentiation (Figure S4F). Gene expression analysis of PB from mice treated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 as compared to control diet at week 3 of treatment revealed a 5-fold decrease of MEIS1 expression suggesting on-target activity of the drug (Figure S4G). Post-mortem FACS analyses revealed significant reductions of leukemia burden, increased differentiation of the remaining leukemia cells in the BM and spleens and a significant reduction of spleen weights in mice engrafted with MLL-r AML (Figure 4D–F). In contrast, {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment of mice engrafted with WT MLL AML PDX resulted in a negligible decrease in leukemia BM infiltration, no increase of differentiation measured by CD11b expression, and splenomegaly (Figures 4G–I).

Mice on {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 and control diets gained weight equivalently and no overt signs of toxicity were detected throughout the treatment. White blood cell, neutrophil and platelet counts and hemoglobin concentration in the PB of mice on control and {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 diets were similar (Figure S4H). Finally, hematopoietic stem cells (Lin⁻ Sca1⁺ Kit⁺) isolated from murine BM and cultured with DMSO or {"type":"entrez-protein","attrs":{"text":"VTP54069","term_id":"1773244844"}}VTP54069 formed similar number of colonies in two rounds of replating (Figure S4I).

After observing the impressive anti-leukemia activity of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 against MLL-r AML (MLL-AML) PDX models, we next assessed its activity against pediatric MLL-r B-ALL PDX models. We engrafted 3 different MLL-AML models (21952, 62871, 22694) and fed them control or {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 formulated chow. The percentage of human cells in the PB began to decline 2-3 weeks after the initiation of treatment, and in 2/3 cases was barely detectable (<0.1%) after 28 days (Figure S5A, Table S3). After 4 weeks of treatment the leukemia burden was significantly reduced in both the BM and spleen (Figure S5B–C). We next used a separate cohort of 8 infant MLL-r ALL PDXs (Table S3) (Richmond et al., 2015), and asked whether {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 administered PO (up to 120 mg/kg BID x 28 days) could provide long-term survival benefits. NSG mice engrafted with MLL-2 (MLL-AF4) experienced a profound prolongation in event-free survival (EFS) following the 28-day {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment (Figure 5A–B), and almost complete resolution of BM, spleen and liver leukemia infiltration at Day 28 (Figure 5C–D, ​ 6A, S6A–B). Moreover, ~50% of the mice treated with 60, 90 and 120 mg/kg {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 for 28 days survived >450 days post treatment, and remained disease free (Figure 5B, ​ 6A–B, S6A–B). Extended survival was also observed in mice engrafted with 6 out of 7 additional MLL-ALL (MLL-1, 3, 5, 6, 7, 8 and 14) treated with 120 mg/kg {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 for 28 days (Figure 6B, S5D), with significant reductions in BM and spleen leukemia infiltration in 5/7 PDXs (Figure S5B–C). Mice engrafted with a B-ALL PDX harboring BCR-ABL1 (ALL-56) and treated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 experienced no delay in disease progression, no increase in survival, and no reduction in BM or spleen leukemia infiltration compared with vehicle-treated mice (Figure 6B, S5A–D). In summary, {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 administered as a single agent for 28 days was able to substantially improve the survival of mice engrafted with aggressive MLL-ALL, and completely eradicated the disease in a high proportion of mice.

{"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 Increases Survival of Mice Engrafted with MLL-r B-ALL PDXs

(A) H&E staining of the BM of naïve and MLL-2-engrafted mice treated with control or {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 at Day 0, 28, and 328. Boxes indicate the %hCD45⁺. Bar, 10 μm.

(B) Swimmer plot of EFS of individual mice engrafted with 8 MLL-r B-ALL PDXs (MLL-1, 2, 3, 5, 6, 7, 8, 14) and a BCR-ABL1 B-ALL PDX (ALL-56) treated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 (120 mg/kg BID 28 days). Hatched area indicates 28 day treatment period. Blue blocks on the end of the lanes indicate mice that were euthanized for non-leukemia related events. Red blocks on the end of the lanes indicated mice that are ongoing in the study.

MEIS1 and MEF2C expression are uniformly suppressed by Menin-MLL inhibition

To assess global gene expression changes in vivo, we isolated hCD45⁺ MLL-ALL cells from the BM of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 or control treated mice and performed RNA-seq. We found that {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment suppressed expression of MLL-AF4 target genes (Figure 7A). We next determined if {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment suppressed similar gene-signatures in PDX models as we observed in cell lines. GSEA demonstrated that {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment significantly suppressed MLL-AF4 target genes and genes that were suppressed by {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 in RS4;11 cells (Figure 7B). Also, genes that lose MLL and Menin occupancy in cell lines, also show decreased expression in mice after treatment of mice with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 (Figure 7B). These experiments demonstrate that {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment suppresses the expression of key MLL-target genes in vivo thus demonstrating on-target activity.

Finally, we asked whether {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 induced uniform changes in gene expression in individual leukemia cells. We utilized single-cell RNA-sequencing (scRNA-seq) and generated molecular profiles of ALL PDX cells harvested from the BM of mice treated for 28 days with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 or vehicle control. We first interrogated the 156 genes that showed >2-fold loss of MLL and Menin occupancy in MOLM13, RS4;11 and ML2 cell lines after {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment (Table S4). PCA identified two clusters consisting of 99 cells from the vehicle control and 108 cells from the {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treated population (Figure 7C). Notably, the first principal component (PC1) was sufficient to separate these two populations and {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treated cells formed a tight cluster with a lower coefficient of variation (CV). These data confirmed that ALL PDX cells uniformly responded to treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469. To identify genes consistently up/down-regulated in an unbiased manner, we further performed differential expression analysis and compared control and {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treated single cells (Figure 7D). Strikingly, we found that MEF2C and MEIS1 were also the two most uniformly repressed genes post {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment in vivo (Figure 7D). These data demonstrate that genes which lose MLL1n and Menin occupancy, including MLL-fusion target genes, decrease in expression and that these changes strongly correlate with in vivo response to {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469. These genes are prime candidates as biomarkers of response in future clinical trials.

DISCUSSION

Recent studies have defined the chromatin-associated protein complexes that are associated with the MLL-fusion protein and critical for continued survival and proliferation of MLL-r leukemia, providing an opportunity for development of therapeutics (Deshpande et al., 2012; Krivtsov et al., 2017; Slany, 2009). An initial wave of small molecule development, including development of DOT1L enzymatic inhibitors and Menin-MLL protein-protein interaction inhibitors, supported the concept that targeted therapies can be developed based on this knowledge (Borkin et al., 2015; Daigle et al., 2013; Grembecka et al., 2012). However, most of these molecules have limitations that have made it difficult to fully assess therapeutic potential. Here we develop a potent, selective and orally available small molecule inhibitor of the Menin-MLL interaction, {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469, that has outstanding PK properties and represents a new chemotype. {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 maintains a key pyrimidine fragment found in Menin-MLL inhibitor MI-2 (Borkin et al., 2015; Grembecka et al., 2012) and, through iterative design, fills the MLL binding pocket in a unique way. {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 inhibits proliferation, induces cellular differentiation and causes apoptosis of leukemia cell lines bearing MLL-rearrangements but has no effect on the cell lines tested that do not have MLL-rearrangements. {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 has dramatic anti-leukemia activity and can eradicate leukemia in PDX models, a result that is rarely seen in PDX models treated with single agent targeted therapy (Jones et al., 2016).

The development of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 has allowed us to interrogate the effect of Menin-MLL inhibition on chromatin-associated proteins including Menin, MLL, and DOT1L. {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment displaced Menin from chromatin genome-wide. In addition, {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment decreased DOT1L chromatin occupancy (~50% globally), potentially as a result of destabilization of the DOT1L protein. The degree of DOT1L destabilization and displacement from chromatin following {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment did not lead to a global decrease in cellular H3K79me2 levels. However, we do note that DOT1L occupancy and H3K79me2 is lost from a subset of MLL-fusion target genes. Of interest, treatment with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 did not evict MLL from chromatin broadly but only from a restricted subset of MLL-fusion target genes which are the same as those that lose DOT1L occupancy and H3K79me2. These changes in chromatin suggest that the Menin-MLL interaction is critical for MLL or MLL-fusion protein function and DOT1L occupancy at a restricted subset of genes that include well-described MLL-fusion targets. However, we do not know if the changes in DOT1L occupancy are essential for the changes in gene expression or the efficacy of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469. Future work will define the molecular relationship between DOT1L and Menin that we have uncovered here. A particularly surprising finding is that Menin-MLL inhibition did not produce much of an effect on MLL-fusion occupancy at HOXA genes. This would not have been predicted by most models. While previous publications suggested that Menin may not be critical for MLL-occupancy at HOXA genes (Kerry et al., 2017; Milne et al., 2010), our inhibitor studies have now demonstrated that this is the case. Given the lack of major changes in chromatin state at HOXA genes it is not surprising that HOXA expression was only modestly suppressed by {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment. These changes were much less pronounced and less consistent than changes observed at other target genes, like MEIS1 where MLL and DOT1L occupancy was lost after treatment. Therefore, the interaction of MLL-fusion proteins and Menin is most critical on a subset of target genes that do not necessarily include HOXA genes. Future studies will define the mechanisms behind the different responses at individual loci, but the focused changes in MLL occupancy may be part of the explanation for the therapeutic window demonstrated here as widespread loss of MLL chromatin binding would likely be deleterious to most hematopoietic cells (Jude et al., 2007).

Developing {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 allowed us to directly compare the gene expression changes induced by a potent, selective Menin-MLL inhibitor to those induced by a potent, selective DOT1L inhibitor. Menin-MLL inhibition and DOT1L inhibition ultimately produce similar changes in gene expression including collapse of much of the MLL-fusion driven program. However, Menin-MLL inhibition shows much more rapid kinetics than DOT1L inhibition. Menin-MLL inhibition led to significant changes in gene expression within 48 hr whereas DOT1L inhibition required 7 days. Previous studies have shown that DOT1L primarily inhibits repressive mechanisms that would otherwise suppress gene expression (Chen et al., 2015). The differences in kinetics of gene expression changes, coupled with the genome wide effects of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treatment, suggest that the Menin-MLL inhibition influences mechanisms beyond DOT1L enzymatic activity. These differences may reflect the fact that a subset of MLL-fusion target genes lose Menin, DOT1L and MLL-fusion occupancy soon after treatment which is unlikely to be the case with a DOT1L inhibitor. Future studies will describe these differential effects in detail. Furthermore, it will be of interest to determine if Menin-MLL inhibition might also influence activity of the SEC that is important for MLL-fusion function (Liang et al., 2017; Smith et al., 2011). Finally, the fact that these two approaches ultimately impinge upon a similar gene expression program supports further assessment of combined treatment with a Menin-MLL inhibitor and a DOT1L inhibitor, as has been shown in other models using less selective molecules (Dafflon et al., 2017; Kuhn et al., 2016).

A particularly exciting aspect of this study is the remarkable single agent activity of this Menin-MLL inhibitor demonstrated in human PDX models of MLL-r AML and ALL. Treatment of PDX models with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 showed marked anti-leukemia activity with minimal side effects during 4 weeks of continuous dosing. Oral administration of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 for 28 days led to almost complete eradication of leukemia cells in BM, PB and spleen in multiple PDX models. Furthermore, the efficacy of Menin-MLL inhibition in MLL-r B-ALL has been difficult to assess to date due to the lack of faithful genetically engineered mouse models and the lack of a Menin-MLL inhibitor with adequate PK properties to perform PDX studies. {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 demonstrated remarkable activity against this subtype of disease and indeed appeared to eradicate disease in multiple mice engrafted with MLL-r B-ALL. Given the dramatic efficacy observed in PDX models, it will be of significant interest to see the single agent activity of such approaches in human clinical trials. The studies described herein provide strong support for the advancement of this approach to clinical assessment in humans.

STAR METHODS

Lead Contact and Materials Availability

Further information and requests for resources and reagents may be directed to and will be fulfilled by the Lead Contact, Scott A. Armstrong (ude.dravrah.icfd@gnortsmra_ttocs). All unique/stable reagents generated in this study are available from the Lead Contact with a completed Materials Tansfer Agreement.

Experimental Model and Subject Details

Animals.

For MV4;11 disseminated xenograft model studies: Female NOD.Cg-Prkdc^scidIl2rg^tm1Wjl/SzJ (NSG) mice at 7-9 weeks of age were purchased form the Jackson Laboratory. For MV4;11 subcutaneous xenograft model studies: Female homozygous Crl:NIH-Foxn1^rnu (RNU) rats of approximately 5 to 7 weeks of age were purchased from Charles River Laboratories. For steady-state plasma level studies: Female CAnN.Cg-Foxn1^nu/Crl (BALB/c) mice were purchased from Charles River Laboratories. For the isolation of LSK cells, C57BL/6NCrl (C57BL/6) were purchased from Charles River Laboratories.

For PDX therapeutic experiments: NOD.Cg-Prkdc^scidIl2rg^tm1Wjl/SzJ (NSG) mice were purchased from Jackson Laboratory for USA studies. All animal experiments were performed with the approval of Dana-Farber Cancer Institute's Institutional Animal Care and Use Committee (IACUC). NOD.Cg-Prkdc^scidIl2rg^tm1Wjl/SzJAusb (NSG) mice were purchased from Australian BioResources for Australian studies. All animal work conducted in Australia was approved by the Animal Care & Ethics Committee, UNSW Sydney (ACEC Approval 16/168B).

Cell lines.

Cell lines were acquired from American Type Culture Collection (ATCC®) or Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ). HL-60 (source: female), K562 (source: female), MOLM13 (source: male), THP1 (source: male), NOMO1 (source: female), ML2 (source: male), EOL1 (source: male), REH (source: female), KOPN8 (source: female), HB11;19 (source: not known), MV4;11 (source: male), SEMK2 (source: female), and RS4;11 (source: female), mouse MOZ-TIF2 cells and mouse MLL-AF9 cells were cultured in RPMI 1640 supplemented with 10% fetal bovine serum, 1× penicillin/streptomycin (Gibco) at 37°C and 5% CO₂. Identification of all cell lines was independently confirmed by cytogenetics profiling.

Patient derived cells.

Samples for patient-derived xenotransplantation were obtained from PRoXe (www.proxe.org) depository (Townsend et al., 2016) or had previously been established as continuous PDXs in immune-deficient mice (Henderson et al., 2008; Liem et al., 2004; Lock et al., 2002; Richmond et al., 2015).

Method Details

Chemical Synthetic Procedures

Synthesis of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 sesquifumarate salt (Scheme S1A).

Stage 1: Preparation of Compound 2.

5-(2-bromo-4-fluorophenoxy)pyrimidine

A 100-L jacketed reactor was charged with 2-bromo-4-fluorophenol (11.00 kg, 57.59 moles, 1.00 equiv., 5-bromopyrimidine (9.43 kg, 59.32 moles, 1.03 equiv.,(Combi-blocks, catalog # PY-1574), cesium carbonate (24.39 kg, 74.87 moles, 1.30 equiv., and dimetylacetamide (66.00 L), and the mixture was heated and stirred at 120 °C over 4 days. The internal temperature of the batch was adjusted to 20–30 °C, was partitioned between deionized water (132.00 L)and MTBE (44.00 L). The layers were separated and the top organic layer was collected. A total of four additional MTBE extractions were performed. The MTBE extracts were combined and washed with 2 N sodium hydroxide (22.00 L,), then by 0.5 M citric acid solution (11.00 L) and finally by 5 wt% sodium bicarbonate solution (11.00 L). The MTBE solution was concentrated using rotary evaporator (25 in. Hg vacuum, 40 °C water bath). The residue was passed through a wiped film evaporator system to remove volatiles (MTBE) and a portion of remaining 5-bromopyrimidine. The conditions for WFE distillation were as follows: the first pass - vacuum 10–15 in. Hg, wiper speed 600 rpm, jacket temperature 150–160 °C, addition rate 4 mL/min; the second pass - vacuum 0.7 Torr, wiper speed 600 rpm, jacket temperature 160–170 °C, addition rate 4 mL/min. The product 2 was isolated in 45% yield (7.15 kg) with HPLC purity 95.3% (AUC).

Proton NMR of compound 2 in CDCl₃ (Figure S7A).

Stage 2-3: Preparation of compound 4.

5-fluoro-2-[(pyrimidin-5-yl)oxy]benzoic acid

A 80-L jacketed stainless steel reactor was charged with palladium catalyst (Pd(dppf)Cl₂ DCM complex) (1.00 kg, 1.22 moles, 0.04 equiv., Johnson Matthey catalog # Pd-106), 2 (8.54 kg, 31.59 moles, 1.00 equiv), triethylamine (6.38 kg, 63.18 moles, 2.00 equiv.), and methanol (42.50 L) under an nitrogen atmosphere and then purged three times with nitrogen and then with carbon monoxide gas (CAUTION: TOXIC GAS) (3 times up to 50 psig of carbon monoxide). The reactor internal temperature was adjusted to 65–75 °C over 75 minutes. Once at temperature, the vessel internal pressure was adjusted to 50 psig with carbon monoxide gas. The reactor contents were stirred 34 hours. After this time, the batch was cooled to 15–25 °C and then purged with nitrogen three times. The reaction was filtered over a Celite™ pad to remove the palladium catalyst.

Proton NMR of compound 3 in CDCl₃ (Figure S7B).

The methanolic solution containing compound 3 was diluted with water (17.00 L). After this, 50 wt% sodium hydroxide aqueous solution (10.11 kg, 126.36 moles, 4 equiv.,) was added keeping the internal temperature in 35–45 °C. Once the addition was complete, the temperature was adjusted to 35–45 °C, target 45 °C and the batch was stirred for 14 hours. HPLC showed complete hydrolysis of 3 to 4. The reaction volume was decreased by vacuum distillation from 87 to 33 liters, then was diluted with water (42.5 L, 7 volumes), cooled to 20–30 °C, and filtered through a Celite™ pad to remove the catalyst. The aqueous layer was extracted with MTBE (17 L) two times. The batch pH was adjusted to 2 using 6 M hydrochloric acid (about 17 L), keeping the temperature at 10–20 °C. Once the acid addition was complete, the batch was cooled to 0–10 °C, and filtered. The filter cake was washed with water (17.00 L) and dried under stream of nitrogen at 40–45 °C until the water level was 0.3 wt% by KF analysis. The product was isolated in 100% yield (7.57 kg) with an HPLC purity of 97.5% (AUC). 1H NMR (DMSO-d6 400 MHz): δ 8.89 (s, 1H), 8.44 (s, 2H), 7.66 (dd, J = 3.2, 8.8 Hz, 1H), 7.52-7.50 (m, 1H), 7.37 (q, J = 4.4 Hz, 1H).

Proton NMR of compound 4 in d-6 DMSO (Figure S7C).

Stage 4: Preparation of Compound 5

5-fluoro-N,N-di(propan-2-yl)-2-[(pyrimidin-5-yl)oxy]benzamide

An 80-L jacketed glass reactor was charged with 4 (3.00 kg, 12.80 moles, 1.00 equiv.), and dichloromethane (30.00 L, 10 volumes). The solution was cooled to 5 °C and N,N-dimethylformamide (56.10 g, 0.77 moles, 0.06 equiv.,) was added. To the resulting solution was added oxalyl chloride (211.20 g, 1.66 moles, 0.13 equiv.). Once the addition was complete, simultaneously were added oxalyl chloride (1.90 kg, 14.98 moles, 1.17 equiv.) and triethylamine (1.18 kg, 11.65 moles, 0.91 equiv.). Once the additions were complete, the reaction was warmed to 15–25 °C, and was stirred for at least 16 hours. The batch temperature was adjusted 5 °C and diisopropylamine (4.01 kg, 39.68 moles, 3.10 equiv.) was added. After the addition was complete, the batch was warmed to 20 °C and was stirred for 2 hours. The reactor contents were washed sequentially with 1 N hydrochloric acid (12 L), and 2 N sodium hydroxide (12 L). The organic layer was concentrated on a rotary evaporator to 2 volumes under reduced pressure. Heptanes (2×30 L, 10 volumes) was added continuously while the batch was concentrated down to about 15 L (5 volumes). The rotary evaporator bulb containing a slurry of the product was removed and was filtered using a fritted funnel. The residue remaining in the bulb was rinsed forward with heptanes (9 L, 3 volumes), and the filter cake was washed with heptanes (9 L, 3 volumes). The material was dried in a vacuum oven at 40–45 °C over 14 hours to afford a 91% yield (3.7 kg) of 5 with an HPLC purity of 98.5% (AUC). 1H NMR (CDCl₃, 400 MHz): δ 8.95 (s, 1H), 8.44 (s, 2H), 7.11 – 6.99 (m, 3H), 3.78 – 3.74 (m, 1H), 3.48 – 3.43 (m, 1H), 1.49 (d, J = Hz, 3H), 1.31 (d, J = 6.8 Hz, 3H), 1.17 (d, J = 6.8 Hz, 3H), 1.13 (d, J = 6.8 Hz, 3H).

Proton NMR of Compound 5 in CDCl₃ (Figure S7D).

Stage 5: Preparation of Compound 6

5-fluoro-2-[(1-oxo-1λ5-pyrimidin-5-yl)oxy]-N,N-di(propan-2-yl)benzamide

To an 80 L reactor was charged intermediate 5 (3.0 kg, 9.453 mol), urea hydrogen peroxide (1.778 kg, 18.90 mol) and pre-cooled THF (3.1 °C, 18.0 L, 6 vol,). Trifluroacetic anhydride (2.67 L, 19.2 mol,) was then slowly added while maintaining a batch temperature < 10 °C. The reaction was quenched by adding 5% NaHCO₃ (15 L) while maintaining a batch temperature less than 10 °C. The product was extracted with dichloromethane (45 L) at 0–15 °C. The organic layer was washed with 5% NaHCO₃ two more times, (2 × 15 L) at 0–15 °C. To the organic layer was added 5% NaHCO₃ (15 L) at 0–15 °C. 1 M Na₂S₂O₃ (18 L,) was slowly added while maintaining a temperature of < 20 °C. This was stirred for 30 min. The phases were then separated. The organic layer was concentrated to 4 volumes under reduced pressure. EtOAc (15 L,) was added and then was concentrated to 5 volumes under reduced pressure. The batch was transferred into a 50 L reactor. Heptane (45 L,) was added. The resulting slurry was stirred for 2 h at 15–25 °C. The slurry was filtered and the solid was then dried in a vacuum oven at 20–30 °C. The product was isolated in 87 % yield and 98.0% HPLC purity (2.732 kg). 1H NMR (CDCl₃ 400 MHz): δ 8.71 (s, 1H), 8.21 (s, 1H), 7.11-7.02 (m, 3H), 3.80-3.74 (m, 1H), 3.53-3.46 (m, 1H), 1.48 (d, J = 6.8 Hz, 3H), 1.34 (d, J = 6.8 Hz, 3H), 1.26 (d, J = 6.4 Hz, 3H), 1.14 (d, J = 6.8 Hz, 3H). 19F NMR (CDCl₃ 400MHz): δ -114.5

Proton NMR of compound 6 in CDCl₃ (Figure S7E).

Stage 6: Preparation of Compound 7

2-[(4-chloropyrimidin-5-yl)oxy]-5-fluoro-N,N-di(propan-2-yl)benzamide

To an 80 L reactor was charged intermediate 6 (2.66 kg, 7.979 mol) and isopropyl acetate (26.6 L). The batch was cooled to −5°C. Diisopropylethylamine (2.95 L, 39.897 mol) was added while maintaining a batch temperature < 5 °C. POCl₃ (0.895 L, 9.575 mol) was added slowly over1 hour while maintaining a batch temperature of 0–10 °C. The temperature was adjusted to 20–25 °C and stirred for 80 minutes. The mixture was cooled to 0–10 °C and H₂O (16.2 L) was added maintaining a temperature < 25 °C and was stirred for 1 hour at 25 °C. The phases were separated. The organic layer was extracted with isopropyl acetate two times (2 × 27 L,). The combined organic layers were concentrated to a residue. The residue was dissolved in Heptane (27 L) and heated to 85–95 °C, decanted leaving a black tar behind. The hot solution was cooled to 15–25 °C and stirred overnight. The resulting slurry was collected by filtration and dried in a vacuum oven at 25–35 °C to give the product as yellow solid (820 g, 89.5% AUC, 29% yield). The residual black tar was dissolved in MeOH and slurried in heptane at 85–95 °C. Additional product was isolate by precipitation and filtration The combined yield for this reaction was 50%. ¹H NMR (CDCl₃): δ 8.71 (s, 1H), 8.21 (s, 1H), 7.02-7.12 (m, 3H), 3.73-3.80 (m, 1H), 3.46-3.53 (m, 1H), 1.49 (d, J = 6.8 Hz, 3H), 1.34 (d, J = 6.8 Hz, 3H), 1.26 (d, J = 6.4 Hz, 3H), 1.14 (d, J = 6.8 Hz, 3H). ¹⁹F NMR (CDCl₃): δ-114.5.

Proton NMR of Compound 7 in CDCl₃ (Figure S7F).

Stage 7: Preparation of Compound 8.

tert-butyl 2-(5-(2-(diisopropylcarbamoyl)-4-fluorophenoxy)pyrimidin-4-yl)-2,7-diazaspiro[3.5]nonane-7-carboxylate

A 20-L jacketed glass reactor was charged with 7 (1.40 kg, 3.98 moles, 1.00 equiv.), tert-butyl 2,7-diazaspiro [3.5]nonane-7-carboxylate 7B (0.92 kg, 3.18 moles, 0.80 equiv., Alchem Pharmtech, catalog # Z-01318), diisopropylethylamine (1.23 kg, 9.55 moles, 2.40 equiv.) and isopropanol (8.12 L). The batch was heated to 75–85 °C, for 2 hours. An additional portion of 7B (92.0 g, 0.32 moles, 0.10 equiv.) and diisopropylethylamine (123 g, 0.96 moles, 0.24 equiv.) were added to the batch and the reaction was heated 2 hours. A last portion of 7B (46.0 g, 0.16 moles, 0.05 equiv.) and diisopropylethylamine (61.50 g, 0.48 moles, 0.12 equiv.) was added and heated 1 hour. HPLC showed the reaction was complete. The reaction mixture was concentrated and was re-dissolved in ethyl acetate (14 L). The ethyl acetate solution was washed sequentially with 0.5 M citric acid (10 L) and 5 wt% sodium bicarbonate solution (14L). The organic layer was concentrated to dryness under reduced pressure. Heptanes (7 L) were added and the batch was stirred at 50 °C for 30 minutes. After this time, the slurry was filtered, washed with heptanes (7L) and the filter cake dried in a vacuum oven at 40–45 °C for 14 hours to afford a 91% yield (1.98 kg) of 8 with an HPLC purity of 97.0% (AUC).

Proton NMR of compound 8 in CDCl₃ (Figure S7G).

Stage 8: Preparation of Compound 11.

2-((4-(2,7-diazaspiro[3.5]nonan-2-yl)pyrimidin-5-yl)oxy)-5-fluoro-N,N-diisopropylbenzamide

A 20-L jacketed glass reactor was charged with 8 (1.90 kg, 2.81 moles, 1.00 equiv), and isopropanol (11.4 L). This was heated to 45–55 °C, a solution of 5 N hydrochloric acid in isopropanol (6.5 L) was added in 500 mL portions. Once the addition was complete, the reaction was stirred at 45–55 °C for one hour. After this time, the temperature was adjusted to 5 °C and the slurry was filtered using a fritted funnel. The filter cake was rinsed with isopropanol (2 L) two times. The material was dried in a vacuum oven at 40–45 °C over 14 hours to afford a 94% yield (1.7 kg) of 11 with an HPLC purity of 97.5% (AUC).

Proton NMR of compound 11 in d-6 DMSO (Figure S7H).

Stage 9: Preparation of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 sesquifumarate.

5-fluoro-N,N-diisopropyl-2-((4-(7-(((trans)-4-(methylsulfonamido)cyclohexyl)methyl)-2,7-diazaspiro[3.5]nonan-2-yl)pyrimidin-5-yl)oxy)benzamide

To an 80-L reactor was charged intermediate 11 (1.7 kg, 3.285 mol), intermediate 9F (1.306 kg, 3.613 mol), KI (573 g, 3.449 mol), K₂CO₃ (1.362 kg, 9.855 mol) followed by N-methyl 2-pyrrolidone (8.45L). The slurry was heated to 65–75 °C and stirred for 16 hours. The reaction was cooled to 0–10 °C and water (10.1 L) added while maintaining a batch temperature < 20 °C. The mixture was extracted with isopropyl acetate (2 × 16.9 L). The combined organics was washed with water (8.5 L). The organic phase concentrated to 4 volumes under reduced pressure at 40–50 °C. EtOH (6.8L) was added and concentrated again to 4 volumes under reduced pressure at 40–50 °C.. This crude free base in EtOH was transferred into a reactor containing Fumaric acid (0.572 g, 4.927 mol) fumaric acid. Additional EtOH (2.5 L) was used to aid the transfer. The batch was heated to 40–50 °C, Methyl-tert-butyl ether (16.9 L) was added slowly over 2 hours while maintaining a batch temperature of 40–50 °C. The mixture was cooled to - 5°C and stirred for 15 hours. The solid was obtained by filtration through a polypropylene cloth. The solids were washed three times with Methyl-tert-butyl ether (13.6 L). This was then dried in a vacuum oven at 40–50 °C. The crude salt was recrystallized from Acetonitrile (20.9 L) and deionized water (700 mL, 15 equiv.) and dried in vacuum oven at 40–50 °C. {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 Sesquifumarate was isolated in 79 % yield and 98.75% HPLC purity as a hydrate (2.08 kg, 1.8 wt% H₂O). MP 176-178.5 °C {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 Free base ¹H NMR (CDCl₃): δ 8.27 (s, 1H), 8.78 (s, 1H), 7.17-7.15 (m, 2H), 7.03-6.99 (m, 1H), 4.06-4.03 (m, 2H), 3.96-3.89 (m, 2H), 3.87-3.84 (m, 1H), 3.66-3.63 (m, 1H), 3.34-3.32 (m, 1H), 3.20-3.15 (m, 1H), 2.95 (s, 3H), 2.55-2.51 (m, 3H), 2.33-2.30 (m, 2H), 2.06-2.04 (m, 2H), 1.89-1.87 (m, 6H), 1.56 (d, J = 6.8 Hz, 4H), 1.48 (d, J = 6.8 Hz, 3H), 1.33-1.30 (m, 2H), 1.20 (d, J = 6.8 Hz, 3H), 1.13 (d, J = 6.4 Hz, 3H), 1.08-1.07 (m, 2H). ¹⁹F NMR (CDCl₃): δ - 119.7.

Proton NMR of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 sesquifumarate in DMSO-d6 (Figure S7I). Certificate of analysis for {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 sesquifumarate salt (Figure S7J). HPLC of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 sesquifumarate salt (Figure S7K).

Synthesis of 9F (Scheme S1B).

Stage A: Preparation of Compound 10A.

methyl trans-4-[(methanesulfonyl)amino]cyclohexane-1-carboxylate

A in a 100L reactor compound 10B (4.2 kg, 21.69 mol, Alchem Pharmatech Inc Z-18301) and dichloromethane (58.8 L,) and was stirred at −5 °C, and then charged with triethylamine (7.55 L, 54.2 mol) over 1 hour. Methanesulfonyl chloride (1.85 L, 23.85 mol) was then added over 1 hour. The batch temperature was then adjusted to 20 −30 °C and held 10 hours. The reaction mixture was cooled to 0–10 °C over 45 minutes and water (28.2 L,) was added. The batch was then warmed to 20–30 °C over 1 h. The organic phase was isolated and the aqueous phase was washed with dichloromethane (16.8 L). The combined organic phases were washed with 1 M hydrochloric acid (16.8 L). The organic layer was concentrated at 35–45 °C to ~34 liters, ethyl acetate (8.4 L) was added, and concentrated again to 34 liters. This was repeated twice more, then heptanes (42.0 L, 10 vol) were added and the mixture was stirred at 25 °C 1 h. The solid was then filtered through an 18' Nusche filter and rinsed twice with heptanes (2 × 8.4 L). The solid was dried in a vacuum oven at 35–45 °C. to give a white solid in 85% yield (4.88 kg) and 89.3 wt% by NMR.

Proton NMR compound 10A in CDCl₃ (Figure S7L).

Stage B: Preparation of Compound 9D.

N-trans[-4-(hydroxymethyl)cyclohexyl]methanesulfonamide

An 80-L reactor was charged with intermediate 10A (5.11 kg, 21.71 mol) and tetrahydrofuran (THF) (51.08 L) then cooled to 0–10 °C. 1 M LAH in THF (21.7 L, 21.71 mol) was added slowly over 8 hours, while maintaining a temperature below 10 °C. The mixture was stirred 18 hours. Water (824 mL) was added over 1.5 hours, maintaining a temperature below 10 °C, This was followed by addition of 3.75 M NaOH (123.6 g NaOH in 700 mL water, followed by a second addition of water (2.47 L) over 15 minutes. The reaction was warmed to 15 −25 °C and stirred for 40 minutes. The reaction was then filtered and the solid was washed and stirred with THF (25.5 L) for 2 hours. This was repeated twice more with THF (2 × 25.5 L). The filtrate was then concentrated on a rotary evaporator at 35 −45 °C until dryness. The crude material was subjected to a silica gel column eluting with 5% MeOH/DCM and gave 1.665 kg of pure (100 wt% by NMR 9D material in 37% yield and 671 g of starting material 10A was recovered.

Proton NMR of 9D in CDCl₃ (Figure S7M).

Stage C: Preparation of Compound 9F.

{trans-4-[(methanesulfonyl)amino]cyclohexyl}methyl 4-methylbenzene-1-sulfonate

To a 50-L reactor was charged compound 9D (1.6 kg, 7.71 mol), DMAP (94.0 g, 0.772 mol), TsCl (2.1 kg, 10.8 mol), and DCM (16 L). The batch temperature was adjusted to 0–10 °C and stirred. Et₃N (2.2 L, 15.43 mol) was added slowly while maintaining a temperature below 10 °C. The reaction temperature was adjusted to 20–30 °C and stirred for 2.5 hours. The batch was then cooled to 0–10 °C and 5% NaHCO₃ (12.8 L, 8 vol) was added while keeping the temperature below 10 °C. The phases were separated, and the aqueous phase was washed with DCM (6.4 L). The combined organic phases were washed twice with 2 M HCl (6.4 L) and then concentrated to 3 volumes at 30–45 °C under reduced pressure. To the product in DCM was then added ethyl acetate (EtOAc, 6.4L) and concentrated to 4 volumes. Then EtOAc (6.4 L) was added and the mixture concentrated to 2 volumes. This was cooled to 15–25 °C, heptane (16.0 L) was added and stirred for 1 hour. The solid which precipitated was collected by filtration through a polypropylene cloth and rinsed twice with heptane (2 × 8.0 L). The material was then dried by vacuum oven at 30–40 °C. The product was isolated in 80% yield and 99.5% HPLC purity (2.235 kg).

Proton NMR of compound 9F in CDCl₃ (Figure S7N).

Binding assays.

Wild-type, full-length Menin with N-terminal HIS tag was synthesized in E.coli and purified using nickel affinity chromatography. FITC-MLL-4-43 was custom synthesized at GenScript, solubilized to 10 mM in DMSO, aliquoted and stored at −20°C. The Tb-anti-HIS Antibody was purchased from ThermoFisher (PV5863). Assays were conducted in 96-well format. Compounds were serially diluted in 100% DMSO at 50× final concentration. For testing, 1 μL of 50× compound titration in DMSO was added to each well. Menin, pre-bound to anti-HIS-Tb, was diluted in assay buffer (0.75 nM, 2× final concentration) in assay buffer (50 mM Tris, pH 7.4, 50 mM NaCl, 0.02% BSA [protease/fatty acid free], 1 mM DTT, 0.005% Triton X-100). To initiate the assay, 25 μL of pre-bound Menin/anti-HIS-Tb were added to each well, followed by 25 μL of FITC-MLL-4-43 in assay buffer at a final concentration of either 0.2 nM for IC₅₀ assays or 3 nM (60× KD) for Ki assays. After overnight incubation, the signal at 320 nm excitation, 520/490 nm emission was measured on an Envision multimode plate reader. The percent inhibition values were plotted against compound concentrations in the assay. The IC₅₀ values were derived using four parameter log non-linear curve fitting (XLFit, IDBS) for the concentration-response curves. The Ki values were calculated based on the relationship: Ki = IC₅₀/(1 + L/KD).

Crystallography.

Use of the IMCA-CAT beamline 17-ID at the Advanced Photon Source was supported by the companies of the Industrial Macromolecular Crystallography Association through a contract with Hauptman-Woodward Medical Research Institute. This research used resources of the Advanced Photon Source U.S. Department of Energy (DOE).

Cell viability, cell differentiation and RNA-seq assays.

Cell lines were acquired from American Type Culture Collection (ATCC®) or Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) and were cultured in RPMI 1640 supplemented with 10% fetal bovine serum, 1× penicillin/streptomycin (Gibco) at 37°C and 5% CO₂. Identification of all cell lines was independently confirmed by cytogenetics profiling. Cells were plated at 5-10×10⁴ cells/mL and treated with limiting dilutions of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 as indicated or 0.1% DMSO. The cells were replated every 3-4 days to the initial density. Viable (DAPI⁻) cells were counted in 25 μL of media using FACS Fortessa (BD Biosciences). Alternatively, MTT (Abcam) or CellTiter-Glo (Promega) assays were performed at various time points followed by either measurement of optical density at 570 nm or luminescence using SpectraMax M5 microplate reader (Molecular Devices). Ratios of either cell numbers or signal from metabolically active cells in {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 to DMSO were then plotted to calculate IC₅₀. Differentiation status of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 or DMSO treated cells was assessed at day 4 by FACS with CD11b-BV421 (BioLegend). For RNA-seq experiments, the cells were plated at 1×10⁵ cells/mL, treated with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 (concentrations as indicated in figure legends) or 0.1-0.33% DMSO for the indicated time. When treated for 7 days, the cells were sub-cultured to the original density at day 3 in fresh media with the same concentration of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 or DMSO. Cells were collected, washed twice in ice-cold PBS before extraction of total RNA using RNeasy kit (Qiagen). The quality of extracted RNA was assessed by RIN using a TapeStation (Agilent) and quantified by Qubit (ThermoFisher). RNA (0.2-1 μg) was used to make Illumina compatible 3'-end libraries using QuantSeq 3'mRNA kit (Lexogen). RNA-seq libraries were then sequenced on NextSeq550 (Illumina) to obtain 1-2×10⁷ unique tags.

For single-cell RNA-seq (scRNA-seq) experiments, PDX cells were harvested from the BM of vehicle control treated mice at event or {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treated mice at Day 28 post treatment initiation. Cell suspensions were stained with anti-human CD45-FITC antibodies; single cells were sorted into 96-well plates and then processed for analysis. Full length transcripts were extracted from single cells using the G&T-seq protocol (Macaulay et al., 2016) followed by scRNA-seq library preparation using the Smart-seq2 protocol (Picelli et al., 2014). Single cell mRNA was reverse transcribed into cDNA using SuperScript II reverse transcriptase (ThermoFisher), followed by PCR amplification. Amplified cDNA from single cells was fragmented and indexed individually using Nextera XT DNA Sample Preparation Kit (Illumina). Libraries were generated and their quality and concentration assessed using an Agilent Bioanalyzer and Qubit, respectively. Single-cell libraries were pooled and sequenced on an Illumina NextSeq500 platform to obtain 1M paired-end 75 bp reads per cell.

Separation of nuclear complexes by size using ultracentrifugation in glycerol gradient.

Glycerol gradient was prepared similarly to previously described (Rani et al., 2012). Nuclear extracts (500 μL, 1 mg of protein) in 50 mM HEPES, pH 8.0, 10% glycerol, 10 mM EDTA, 0.5 mM DTT, 300 mM NaCl were layered onto 10 ml of 10-30% glycerol gradient followed by ultracentrifugation for 16 hr at 4°C at 40,000 RPM in SW 55 Ti rotor (Beckman Coulter). 21 fractions 550 μL each were collected and 50 μL of each fraction were analyzed by immunoblotting with anti-Menin antibody (Bethyl).

Immunoblotting.

5×10⁴ PBS washed cells were lysed in 50 μL of 1× loading buffer supplemented with 10 mM DTT and denatured for 10 min at 95°C. Samples were loaded (20 μL per lane) onto either 10% Bis-Tris or Tris-Acetate gels (ThermoFisher), proteins were separated by electrophoresis for 2 hr then transferred onto nitrocellulose membrane using semi-dry transfer (ThermoFisher). The membranes were blocked in 5% dry milk for 30 min and incubated overnight with anti-Menin (Bethyl), anti-DOT1L (Cell Signaling), anti-H3K79me2 (Abcam) or anti-GAPDH (Cell Signaling) antibody. The next day membranes were washed in TBST and developed using a secondary rabbit anti-HRP (Cell Signaling) and chemiluminescence kit (Pierce).

Chromatin immunoprecipitation.

Cells treated with either DMSO or {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 were crosslinked in 1% methanol-free formaldehyde (ThermoFisher) for 7-10 min at room temperature, followed by quenching of remaining formaldehyde with 100 mM Tris pH8.0 and 25 mM Glycine. Cytoplasm was stripped using 50 mM Tris-HCl pH 8.0, 100 mM NaCl, 5 mM EDTA, 1% SDS for 10 min at ambient temperature followed by precipitation of nuclei by centrifugation at 10,000 ×g. The nuclei were then resuspended in 66 mM Tris-HCl pH 8.0, 100 mM NaCl, 5 mM EDTA, 1.7% Triton X-100, 0.5% SDS and sheared using E100S (Covaris) to chromatin fragments of 200-400 base-pair DNA size. 1-5 μg of chromatin was used per immunoprecipitation with anti-Menin (Bethyl), MLLn (Bethyl), DOT1L (Cell Signaling) antibodies and protein-A magnetic beads (Dynal). Immunoprecipitated DNA fragments were eluted and de-crosslinked in 100 mM NaHCO₃, 100 mM NaCl, 1% SDS, and quantified by TapeStation (Agilent) and Qubit (ThermoFisher). 1-10 ng of DNA was used in preparation of Illumina-compatible libraries using SMARTer ThruPLEX DNA-Seq Kit (Takara) followed by sequencing using NextSeq550 (Illumina) to obtain 1-5×10⁷ unique sequencing paired-end tags.

CUT&RUN.

MOLM13 cells expressing Cas9 (MOLM13:Cas9) were infected with control or MEN1 sgRNAs by spinfection (1ml, 0.7mg/ml polybrene, 37C, 1000 x g). After 2 days, cells were selected with puromycin for 4 days. CUT&RUN was performed as described in Skene and Henikoff (2017). In short, 5x10⁵ cells were washed twice in PBS, then once in a wash buffer (20mM HEPES pH 8.0, 150 mM NaCl, 0.5mM spermidine) followed by immobilization on Concanavalin A magnetic beads activated in binding buffer (20mM HEPES pH 8.0, 10mM KCl, 1mM CaCl₂, 1mM MnCl₂) (Polyscience). The immobilized cells were permeabilized by washing in wash buffer supplemented with 0.1% Triton-X100 and incubated with anti-MLL1n antibody (Bethyl) at 4°C with addition of EDTA to 2mM. After 2-hour incubation the cells were washed twice and incubated with Protein-A-MNase conjugate at 4°C. After 4 hours the cells were washed twice and MNase was activated by addition CaCl₂ to 20mM. The DNA digestion was stopped by addition EDTA and EGTA both to 10mM along with spike-in 10pM of Drosophila melanogaster chromatin. DNA fragments were collected in supernatant and purified using 1.8x AMPure XP beads (Beckman Coulter) which were then converted to Illumina compatible libraries using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs) followed by sequencing using NextSeq550 (Illumina).

ChIP-seq, CUT&RUN-seq, RNA-seq, scRNA-seq data analyses.

Raw Illumina sequencer output was converted to FASTQ format using bcl2fastq (v2.17). Reads (37- or 75-mers) were trimmed for quality using trimmomatic (v0.36; minimum trimmed length 34bp), aligned to the human genome (hg19) using STAR (v2.6.1b), sorted and duplicates marked/removed with picard pipeline tools (v2.9.4). Final "deduped" .BAM files were indexed using SAMtools (v1.2). For ChIP-seq, total signal was assessed around transcription start site (TSS) regions using the sitepro tool (v0.6.6) from the CEAS (Cis-regulatory Element Annotation System) package (using signal windows from TSS extending 10kb into the gene body with 100bp tiling and signal summed across each window), based on signal from WIG files generated using IGVtools (v2.3.98) ChIP-seq data visualizations were produced using IGVtools (TDF signal pileups) and ngs.plot (pileup heatmaps). For RNA-seq, raw counts calculated with HTSeq (htseq-count, v0.6.1pl). Duplicate reads were marked with picard tools (v2.9.4), but were not removed, due to the nature of the RNA-seq sequencing protocol used. Raw counts were used to calculate differential expression values for DMSO- and {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469-treated samples with the R Bioconductor DESeq2 package (v1.24.0). Results were filtered to exclude non-protein-coding genes (based on Ensembl gene biotype annotations) and low-expressed genes (those with values less than 1 in log scale for both treatments). Expression differentials of greater than two-fold and adjusted pValue < 0.05 were considered significant. Counts were converted to counts per million reads (CPM) for each sample for further analysis. CPM values were used in gene set enrichment analysis (GSEA) to assess enrichment significance of tested gene sets (Table S5) in either DMSO or {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 phenotypes.

For CUT&RUN-seq analysis, FASTQ files were processed using a version of the published CUT&RUNTools suite (Zhu et al., 2019), modified to run on a local computer cluster. Briefly, reads were trimmed using trimmomatic and aligned to the human genome (hg19) with Bowtie2. Resulting BAM files were sorted, duplicates marked and filtered for fragments <120bp (all with samtools), and peaks called (with MACS2). WIG files were produced from filtered BAM files (with duplicate reads marked but not removed), and sitepro used to assess TSS region signal, as described for ChIP-seq above.

For scRNA-seq analysis, 75 bp paired end sequencing reads were aligned to the human genome (hg19) using STAR (Dobin et al., 2013) resulting in more than 10⁶ mapped reads per cell. A total of 207 single cells were analyzed after stringent bioinformatics filtering including the removal of 14 cells due to small library sizes (<500k reads) and 3 cells due to low alignment rates (<85%). Expression profiles of 99 control and 108 {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 treated cells were generated using featureCounts (Liao et al., 2014). Principal component analysis (PCA) was performed using MATLAB (R2018b). Differential expression analysis was performed on normalized read counts (transcripts per million bp) using the edgeQRF algorithm (Robinson et al., 2010).

Principal Component Analysis.

For PCA of single-cell gene expression in MLL-r ALL PDX we used the union of genes (156) that lose >2-fold MLL1n chromatin occupancy in MOLM13, RS4;11 and ML2 cells resulted in 27 genes (of 156) for which >3 tags/gene were available across the 207 cells by scRNA-seq that were used for PCA analysis. The PCA plot was prepared with RNA sequencing per-gene count data produced by the HTSeq count algorithm, following an unbiased (blinded) variance stabilizing transformation (VST) in the R Bioconductor package DESeq2.

MV4;11 disseminated xenograft model in NSG mice.

Studies were conducted in female NOD.Cg-Prkdc^scidIl2rg^tm1Wjl/SzJ (NSG) mice (Jackson Laboratory) of 7-9 weeks of age on day 0 of the experiment. MV4;11-FUW-Luc-mCh-Puro cells were grown in RPMI 1640 medium supplemented with 10% non-heat-inactivated Fetal Bovine Serum and 1% 100× Penicillin/Streptomycin/L-Glutamine (PSG). When expansion was complete, cells were prepared for implantation by pelleting at 200 ×g for 10 minutes at 4°C. The pellet was washed and resuspended in cold Dulbecco's Phosphate Buffered Saline (DPBS) by pipetting at a final concentration of 1.0×10⁷ trypan-excluding cells/mL. Mice were implanted intravenously on day 0 with 2×10⁶ cells/mouse in 200 μL of DPBS using a 27-gauge needle and syringe. The mice were randomized into four treatment groups (n=10) based on body weight. The groups included a vehicle control (0.5% Methocel/H2O) and three {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 groups (15, 30, 60 mg/kg BID). Treatment began on day 5 and continued for 28 days. All mice were dosed orally according to individual body weight (10 mL/kg) twice per day, approximately 12 hr apart. On day 75, any remaining mice were euthanized by CO₂ asphyxiation. Lifespan was analyzed by Kaplan-Meier survival - Log-Rank.

MV4;11 subcutaneous xenografts in nude rats.

Studies were conducted in female homozygous Crl:NIH-Foxn1^rnu (RNU) rats (Charles River Laboratories) of approximately 5 to 7 weeks of age. Animals were transplanted with MV4;11 cells subcutaneously (s.c.) into the right flank (1×10⁷ cells in 100 μL PBS and 100 μL Matrigel). When tumors reached ~200-250 mm³, animals were randomized into treatment groups. For acute, steady-state pharmacokinetic/pharmacodynamic (PK/PD) studies, solutions of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 sesquifumarate salt were prepared at three dose strengths (0.8, 4.0 and 20 mg/mL) along with a vehicle solution (PEG-400 and PBS). These solutions were instilled into Alzet mini-pumps (Model 2 ML1, 10.0 μL/hr) and pumps were implanted s.c. in the contralateral flank in each treatment group (n=3 per group). Tumor sizes were measured at days 0, 2, and 4, at which point animals were euthanized. Tumors were dissected out, cut into small pieces (25-50 mg) and promptly flash-frozen in liquid nitrogen for RNA analysis. In addition, heparinized blood was collected from each animal, plasma was prepared and flash frozen. Plasma levels of drug were determined by HPLC/MS/MS.

LSK cell sort and culture in semisolid media.

Hematopoietic stem cell-enriched Lineage⁻ Sca1⁺c-KIT/CD117⁺ (LSK) cells were isolated from the BM of 8-10 week old C57BL/6 mice (Charles River Laboratories). Lineage depletion was performed using EasySep™ Mouse Hematopoietic Progenitor Cell Isolation Kit (STEMCELL Technologies). Subsequently, cells were washed, and lin⁺ cells were removed using magnetic beads (Dynabeads; Invitrogen). Cells were identified with anti-mouse Sca1-Alexa Fluor 647 and anti-mouse CD117-APC (Biolegend) using flow-sorting. LSK cells (500 cells/plate in triplicate) were cultured in StemSpan SFEM (STEMCELL Technologies) containing 100 ng/ml rmSCF/rmFLT3/rmTPO with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 (30nM) or DMSO (0.1%) for two rounds of replating. At each replating, the number of colonies was scored.

MLL-AF9 murine leukemia treatment.

Murine MLL-AF9 AML was generated from LSK cells as previously described in Krivtsov et al. (2006). Secondary recipient mice were transplanted with 2x10⁴ BM cells from primary recipients that developed AML. On day 10 post transplantation the mice were randomly split into 2 cohorts and each cohort was dosed with either 0.1% {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 or control diet for 40 days. The mice were bled weekly starting from day 20 to assess percent of GFP+ cells in peripheral blood. On day 69 all the mice were sacrificed and AML burden was assessed by FACS in peripheral blood, spleen and BM as %GFP+. For survival studies, mice were transplanted with 2.5x10⁵ BM cells from secondary AML mice. On day 10 post transplantation the mice were randomly split into 2 cohorts and each cohort was dosed with either 0.1% {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 or control diet for 35 days and monitored for survival. Moribund mice were euthanized and analyzed for leukemia burden.

Lentiviral infection of human cells:

Guide RNA targeting MEN1 were designed using BROAD GPP tool (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design) (Doench et al., 2014) yielding hMenin1_sgRNA1 -5' CACCTGCTGCGATTCTACGA and hMenin1_sgRNA2 5' GAACGTTGGTAGGGATGACG which were cloned into pLKO5.sgRNA.EFS.tRFP657 (Addgene 57822). Lentiviral particles were produced in 293T cells by transient co-transfection of pLKO5.sgRNA.EFS.tRFP657, pMD2.G and psPAX2 3 ug each for 10 cm tissue culture plate. The viral supernatant was collected in three batches within 24-48 hour intervals post transfection. MOLM13:Cas9 cells were spinfected at 800xg, 37C for 1h with lentiviral supernatant supplemented with polybrene (0.7ug/ml). Infection efficiency was >80% by FACS. The cells expressing guides were selected in 2 ug/ml puromycin (ThermoFisher) starting day 2 post infection. Cells were collected for RNA-seq or CUT&RUN-seq analyzes on day 6 post infection.

Assessment of in vivo efficacy using PDXs.

Samples for patient-derived xenotransplantation were obtained from PRoXe (www.proxe.org) depository (Townsend et al., 2016) or had previously been established as continuous PDXs in immune-deficient mice (Henderson et al., 2008; Liem et al., 2004; Lock et al., 2002; Richmond et al., 2015). 1-10×10⁵ cells were intravenously (i.v.) transplanted into each of 7-20 unconditioned immunodeficient (NSG) mice (Jackson Laboratory for USA studies or Australian BioResources for Australian studies). Starting from weeks 2-5 post-transplantation mice were bled weekly to enumerate human CD45⁺ (hCD45⁺) cells in the peripheral blood by FACS with anti-mouse CD45-FITC or TER119-FITC and human (h) CD45-APC antibodies. When the median engraftment reached 0.1% (USA studies) or 1% (Australian studies) hCD45⁺ cells in the peripheral blood (PB), mice were randomly assigned into 2 groups and started dosing either with {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 orally (PO) twice daily (BID) at up to 120 mg/kg for 28 days; or 0.1% {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 spiked-in chow. The mice were bled weekly to assess leukemia burden using anti-mouse CD45-FITC or TER119-FITC, anti-human CD45-APC and for differentiation status using anti-human CD11b-BV421. White blood cell, neutrophil, and platelet counts as well as hemoglobin concentration were measured using Hemavet (Drew Scientific) automated flow cytometer according to manufacturer supplied protocol. Some of the mice were euthanized at day 28 to 43 to assess leukemia burden in BM and spleens. Samples of BM, spleens and livers were fixed in 10% formalin and embedded in paraffin for sectioning. Sections were stained with Haemotoxylin and Eosin (H&E) to visualize hematopoietic cells. In survival experiments the mice were bled monthly during the post-treatment period to assess hCD45⁺ cells to monitor relapse with human leukemia. Individual mouse event-free survival (EFS) was calculated as the number of days from treatment initiation until the %hCD45⁺ reached 25%, computed by interpolating between bleeds directly preceding and following events, assuming log-linear growth.

Quantification and Statistical Analysis

Statistical information is indicated in the text or the figure legends. We used Student's t-test (unpaired, two-tailed) to assess significance between treatment and control groups. The Gehan-Wilcoxon test was used to assess the significance in EFS experiments to calculate p values. p < 0.05 was considered significant. We used hypergeometric distribution p-value to assess significance of gene overlaps. Generation of plots and statistical analyses were performed using Prism version 7 software (GraphPad).

​

Key Resources Table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Tb-anti-HIS Antibody	ThermoFisher	PV5863
Anti-human CD45-APC	BioLegend	368512
Anti-mouse CD45-FITC	BioLegend	103108
Anti-mouse TER119-FITC	BioLegend	116206
Anti-human CD11b-BV421	BioLegend	101235
Anti-human CD45-FITC	BioLegend	368508
Anti-Menin	Bethyl	A300-105A
Anti-H3K79me2, clone D15E8	Cell Signaling	5427
Anti-H3K79me2	AbCam	Ab3594
Anti-DOT1L (D1W4Z)	Cell Signaling	77087
Anti-MLL1n	Bethyl	A300-086A
Anti-GAPDH (14C10)	Cell Signaling	2118
Anti-rabbit IgG, HRP-linked Antibody	Cell Signaling	7074
Protein-A magnetic beads	Dynal	10002D
Anti-mouse Ly-6A/E (Sca1)-Alexa Fluor 647, clone D7	BioLegend	108117
Anti-mouse CD117-APC/Cyanine7, clone 2B8	BioLegend	105825
Biological Samples: Patient-derived xenografts (PDX)
PDX 40315 (AML, t(9;11), MLL-AF9)	Townsend et al., 2016	www.proxe.org, DFAM-40315-V2
PDX 68552 (AML, MLL-AF6)	Townsend et al., 2016	www.proxe.org, CBAM-68552-V1
PDX 21952 (B-ALL, t(4;11)(q21 ;q23), MLL-AF4)	Townsend et al., 2016	www.proxe.org, CBAB-21952-V0
PDX 62871 (B-ALL, t(4;11)(q21;q23), MLL-AF4)	Townsend et al., 2016	www.proxe.org, CBAB-62871-V1
PDX 22694 (B-ALL, MLL-r by FISH)	Townsend et al., 2016	www.proxe.org, CBAB-22694-V1
PDX MLL-1 (B-ALL, t(1 ;11), MLL-EPS15)	Richmond et al., 2015	MLL-1
PDX MLL-2 (B-ALL, t(4;11), MLL-AF4)	Richmond et al., 2015	MLL-2
PDX MLL-3 (B-ALL, t(11;17), MLL-GAS7)	Richmond et al., 2015	MLL-3
PDX MLL-5 (B-ALL, t(10;11), MLL-AF10)	Richmond et al., 2015	MLL-5
PDX MLL-6 (B-ALL, t(11;19), MLL-ENL)	Richmond et al., 2015	MLL-6
PDX MLL-7 (B-ALL, t(4;11), MLL-AF4)	Richmond et al., 2015	MLL-7
PDX MLL-8 (B-ALL, t(11 ;19), MLL-ENL)	Richmond et al., 2015	MLL-8
PDX MLL-14 (B-ALL, t(11;19), MLL-ENL)	Henderson et al., 2008	MLL-14
PDX ALL-56 (B-ALL, t(9;22), BCR-ABL)	This paper	ALL-56
PDX 70506 (AML, MLL1-wt; NPM1-wt; IDH2; TP53)	Townsend et al., 2016	www.proxe.org, MDAM-70506-V1
Chemicals, Peptides, and Recombinant Proteins
FITC-MLL-4-43	GenScript	custom
DMSO	Sigma Aldrich	D2650-5X10ML
{"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469	This paper	{"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469
0.1% {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 containing mouse chow	Envigo	Rx2144235 TD 160784
Control Teklad Diet	Envigo	2020
SuperScript II Reverse Transcriptase	ThermoFisher	18064014
MTT	Abcam	ab211091
Critical Commercial Assays
CellTiter-Glo	Promega	G7571
RNeasy kit	Qiagen	74106
QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina	Lexigen	015.96
Nextera XT DNA Sample Preparation Kit	Illumina	FC-131-1024
SMARTer ThruPLEX DNA-Seq Kit	Takara	R400675
EasySep™ Mouse Hematopoietic Progenitor Cell Isolation Kit	STEMCELL Technologies	19856
AMPure XP	Beckman Coulter	A63880
NEBNext® Ultra™ II DNA Library Prep Kit for Illumina	New England BioLabs	E7645S
Deposited Data
Raw and analyzed scRNA-seq data	This paper	GEO: {"type":"entrez-geo","attrs":{"text":"GSE127298","term_id":"127298"}}GSE127298
Raw and analyzed CUT&RUN-seq, ChIP-seq and RNA-seq data	This paper	GEO: {"type":"entrez-geo","attrs":{"text":"GSE127508","term_id":"127508"}}GSE127508
Co-crystal of {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 and Menin-MLL	This paper	PDB6PKC
Experimental Models: Cell Lines
Human: HL-60	ATCC	CCL-240
Human: K562	ATCC	CCL-243
Human: MOLM13	DSMZ	ACC 554
Human: THP1	ATCC	TIB-202
Human: NOMO1	DSMZ	ACC 542
Human: ML2	DSMZ	ACC 15
Human: EOL1	DSMZ	ACC 386
Human: Reh	ATCC	CRL-8286
Human: KOPN8	DSMZ	ACC 552
Human: HB11;19	Laboratory of Kimberley Stegmaier (DFCI/Broad)	N/A
Human: MV4;11	ATCC	CRL-9591
Human: SEMK2	DSMZ	ACC 546
Human: RS4;11	ATCC	CRL-1873
Human: MV4;11-FUW-Luc-mCh-Puro	MI Bioresearch	86F
Mouse: MOZ-TIF2	Deguchi et al., 2003	N/A
Mouse: MLL-AF9	Krivtsov et al., 2006	N/A
Human: MOLM13:Cas9	Laboratory of Kimberley Stegmaier (DFCI/Broad)	N/A
Experimental Models: Organisms/Strains
Mouse: NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ (NSG)	Jackson Labs	005557
Mouse: NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJAusb (NSG)	Australian BioResources	GM Strain
Rat: Crl:NIH-Foxn1rnu (RNU)	Charles River Laboratories	RNU Rat
Mouse: CAnN.Cg-Foxn1nu/Crl (BALB/c)	Charles River Laboratories	BALB/c Nude Mouse
Mouse: C57BL/6NCrl (C57BL/6)	Charles River Laboratories	C57BL/6 Mouse
Recombinant DNA
Menin with N-terminal HIS tag expressed in E.Coli	This paper	N/A
Software and Algorithms
bcl2fastq Conversion Software, v2.17	Illumina, Inc.	https://support.illumina.com/sequencing/sequencing_software/bcl2fastq-conversion-software.html
STAR, v2.6.1b	Dobin et al. 2013	https://github.com/alexdobin/STAR
Human genome, UCSC hg19	Illumina iGenomes	https://support.illumina.com/sequencing/sequencing_software/igenome.html
CEAS v1.0.2 (sitepro v0.6.6)	Shin et al., 2009	http://liulab.dfci.harvard.edu/CEAS/
IGVtools, 2.3.98	Robinson et al., 2011; Thorvaldottir et al., 2013; Robinson et al., 2017	https://software.broadinstitute.org/software/igv/igvtools
Samtools, v1.2	Li et al., 2009	http://www.htslib.org/
HTSeq, htseq-count, v0.6.1pl	Anders et al., 2014	https://htseq.readthedocs.io/en/release0.11.1/
Picard tools, v2.9.4	Broad Institute	https://broadinstitute.github.io/picard/
GSEA, v.3.160	Subramanian et al., 2005; Mootha et al., 2003	http://software.broadinstitute.org/gsea/index.jsp
R Bioconductor DESeq2 package v1.24.0	Love et al., 2014	https://bioconductor.org/packages/release/bioc/html/DESeq2.html
Integrated Genome Viewer (IGV), 2.3.97	Robinson et al., 2011; Thorvaldottir et al., 2013; Robinson et al., 2017	http://software.broadinstitute.org/software/igv/
MATLAB, R2018b	The MathWorks, Inc	https://www.mathworks.com/products/matlab.html
featureCounts	Liao et al., 2014	http://subread.sourceforge.net/
edgeQRF algorithm	Robinson et al., 2010	http://bioconductor.org
CUT&RUNTools	Zhu et al., 2019	https://bitbucket.org/qzhudfci/cutruntools/src/default/README.md

SIGNIFICANCE

Rearrangements of the Mixed Lineage Leukemia (MLL1) gene define an aggressive leukemia for which new therapeutic approaches are desperately needed. Recent studies have elucidated the chromatin-based mechanisms used by MLL-fusion proteins to drive leukemia thus suggesting potential therapeutic opportunities. We have developed a unique small molecule inhibitor of the Menin-MLL interaction that has outstanding pharmaceutical properties such that we can assess efficacy of this approach in PDX models of MLL-r leukemia. Importantly this includes assessment of MLL-r infant ALL, an aggressive pediatric leukemia. {"type":"entrez-protein","attrs":{"text":"VTP50469","term_id":"1773223164"}}VTP50469 produced dramatic single agent responses and cured a substantial number of mice of the human leukemia. We anticipate that these responses will predict success in humans with this aggressive disease.

Supplementary Material

1

2

Table S1 related to Figures 2 and S2. List of genes that significantly change expression >2-fold in MOLM13 or RS4;11 cells upon 2- or 7-day treatment with VTP-50469 or after 6 days of MEN1 knockout.

3

Table S2 related to Figures 3 and S3. Gene occupancy of Menin, MLL1n, DOT1L or H3K79me2 in ML-2, MOLM13, RS4;11 cells and MOLM13 cells with MEN1 knock out.

4

Table S3, related to Figures 4 and ​ 5. PDX samples that were used in the study.

5

Table S4, related to Figure 7. List of genes that lose occupancy >2-fold of MLL1 and Menin in one of MOLM13, RS4;11 and ML-2 cells.

6

Table S5, related to STAR Methods. Lists of genes in the gene sets used for GSEA.

ACKNOWLEDGEMENTS

The authors thank Sayuri Kitajima, Elizabeth Frank and Nazar Mashtalir for technical help, and Chelsea Mayoh and Stephen W. Erickson for interpreting the data. This research was supported by grants: S.A.A.: Cookies for Kids' Cancer, Wicked Good Cause, NIH/NCI P50 CA206963, R01 CA176745, R01 CA204639, P01 CA066996; R.B.L.: U01 CA199000, U01 CA199222, NHMRC Fellowships APP1059804 and APP1157871; J.E.P.: NHMRC Project Grants APP1102589 and APP1139787; D.J.: Cancer Institute NSW Early Career Fellowship; U.S. Department of Energy Contract No. DE-AC02-06CH11357.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

DECLARATION OF INTERESTS

S.A.A. has been a consultant and/or shareholder for Epizyme Inc, Vitae/Allergan Pharmaceuticals, Imago Biosciences, Cyteir Therapeutics, C4 Therapeutics, Syros Pharmaceuticals, OxStem Oncology, Accent Therapeutics and Mana Therapeutics. S.A.A. has received research support from Janssen, Novartis, and AstraZeneca. G.M.M. is a shareholder of Syndax Pharmaceuticals. All other authors declare no conflicts of interest.

REFREFERENCES

• Anders S, Pyl PT, and Huber W (2015). HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics (Oxford, England) 31, 166–169. [PMC free article] [PubMed] [Google Scholar]
• Armstrong SA, Staunton JE, Silverman LB, Pieters R, den Boer ML, Minden MD, Sallan SE, Lander ES, Golub TR, and Korsmeyer SJ (2002). MLL translocations specify a distinct gene expression profile that distinguishes a unique leukemia. Nat Genet 30, 41–47. [PubMed] [Google Scholar]
• Bernt KM, Zhu N, Sinha AU, Vempati S, Faber J, Krivtsov AV, Feng Z, Punt N, Daigle A, Bullinger L, et al. (2011). MLL-rearranged leukemia is dependent on aberrant H3K79 methylation by DOT1L. Cancer Cell 20, 66–78. [PMC free article] [PubMed] [Google Scholar]
• Bitoun E, Oliver PL, and Davies KE (2007). The mixed-lineage leukemia fusion partner AF4 stimulates RNA polymerase II transcriptional elongation and mediates coordinated chromatin remodeling. Hum Mol Genet 16, 92–106. [PubMed] [Google Scholar]
• Borkin D, He S, Miao H, Kempinska K, Pollock J, Chase J, Purohit T, Malik B, Zhao T, Wang J, et al. (2015). Pharmacologic inhibition of the Menin-MLL interaction blocks progression of MLL leukemia in vivo. Cancer Cell 27, 589–602. [PMC free article] [PubMed] [Google Scholar]
• Brown FC, Still E, Koche RP, Yim CY, Takao S, Cifani P, Reed C, Gunasekera S, Ficarro SB, Romanienko P, et al. (2018). MEF2C Phosphorylation Is Required for Chemotherapy Resistance in Acute Myeloid Leukemia. Cancer Discov 8, 478–497. [PMC free article] [PubMed] [Google Scholar]
• Charles NJ, and Boyer DF (2017). Mixed-Phenotype Acute Leukemia: Diagnostic Criteria and Pitfalls. Arch Pathol Lab Med 141, 1462–1468. [PubMed] [Google Scholar]
• Chen CW, Koche RP, Sinha AU, Deshpande AJ, Zhu N, Eng R, Doench JG, Xu H, Chu SH, Qi J, et al. (2015). DOT1L inhibits SIRT1-mediated epigenetic silencing to maintain leukemic gene expression in MLL-rearranged leukemia. Nat Med 21, 335–343. [PMC free article] [PubMed] [Google Scholar]
• Dafflon C, Craig VJ, Mereau H, Grasel J, Schacher Engstler B, Hoffman G, Nigsch F, Gaulis S, Barys L, Ito M, et al. (2017). Complementary activities of DOT1L and Menin inhibitors in MLL-rearranged leukemia. Leukemia 31, 1269–1277. [PubMed] [Google Scholar]
• Daigle SR, Olhava EJ, Therkelsen CA, Basavapathruni A, Jin L, Boriack-Sjodin PA, Allain CJ, Klaus CR, Raimondi A, Scott MP, et al. (2013). Potent inhibition of DOT1L as treatment of MLL-fusion leukemia. Blood 122, 1017–1025. [PMC free article] [PubMed] [Google Scholar]
• Deguchi K, Ayton PM, Carapeti M, Kutok JL, Snyder CS, Williams IR, Cross NC, Glass CK, Cleary ML, and Gilliland DG (2003). MOZ-TIF2-induced acute myeloid leukemia requires the MOZ nucleosome binding motif and TIF2-mediated recruitment of CBP. Cancer Cell 3, 259–271. [PubMed] [Google Scholar]
• Deshpande AJ, Bradner J, and Armstrong SA (2012). Chromatin modifications as therapeutic targets in MLL-rearranged leukemia. Trends Immunol 33, 563–570. [PMC free article] [PubMed] [Google Scholar]
• Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, and Gingeras TR (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics (Oxford, England) 29, 15–21. [PMC free article] [PubMed] [Google Scholar]
• Doench JG, Hartenian E, Graham DB, Tothova Z, Hegde M, Smith I, Sullender M, Ebert BL, Xavier RJ, and Root DE (2014). Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol 32, 1262–1267. [PMC free article] [PubMed] [Google Scholar]
• Grembecka J, He S, Shi A, Purohit T, Muntean AG, Sorenson RJ, Showalter HD, Murai MJ, Belcher AM, Hartley T, et al. (2012). Menin-MLL inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia. Nat Chem Biol 8, 277–284. [PMC free article] [PubMed] [Google Scholar]
• Guenther MG, Lawton LN, Rozovskaia T, Frampton GM, Levine SS, Volkert TL, Croce CM, Nakamura T, Canaani E, and Young RA (2008). Aberrant chromatin at genes encoding stem cell regulators in human mixed-lineage leukemia. Genes Dev 22, 3403–3408. [PMC free article] [PubMed] [Google Scholar]
• Guo H, Chu Y, Wang L, Chen X, Chen Y, Cheng H, Zhang L, Zhou Y, Yang FC, Cheng T, et al. (2017). PBX3 is essential for leukemia stem cell maintenance in MLL-rearranged leukemia. Int J Cancer 141, 324–335. [PubMed] [Google Scholar]
• Henderson MJ, Choi S, Beesley AH, Baker DL, Wright D, Papa RA, Murch A, Campbell LJ, Lock RB, Norris MD, et al. (2008). A xenograft model of infant leukaemia reveals a complex MLL translocation. Br J Haematol 140, 716–719. [PubMed] [Google Scholar]
• Jones L, Carol H, Evans K, Richmond J, Houghton PJ, Smith MA, and Lock RB (2016). A review of new agents evaluated against pediatric acute lymphoblastic leukemia by the Pediatric Preclinical Testing Program. Leukemia 30, 2133–2141. [PubMed] [Google Scholar]
• Jude CD, Climer L, Xu D, Artinger E, Fisher JK, and Ernst P (2007). Unique and independent roles for MLL in adult hematopoietic stem cells and progenitors. Cell Stem Cell 1, 324–337. [PMC free article] [PubMed] [Google Scholar]
• Kerry J, Godfrey L, Repapi E, Tapia M, Blackledge NP, Ma H, Ballabio E, O'Byrne S, Ponthan F, Heidenreich O, et al. (2017). MLL-AF4 Spreading Identifies Binding Sites that Are Distinct from Super-Enhancers and that Govern Sensitivity to DOT1L Inhibition in Leukemia. Cell Rep 18, 482–495. [PMC free article] [PubMed] [Google Scholar]
• Krivtsov AV, and Armstrong SA (2007). MLL translocations, histone modifications and leukaemia stem-cell development. Nat Rev Cancer 7, 823–833. [PubMed] [Google Scholar]
• Krivtsov AV, Feng Z, Lemieux ME, Faber J, Vempati S, Sinha AU, Xia X, Jesneck J, Bracken AP, Silverman LB, et al. (2008). H3K79 methylation profiles define murine and human MLL-AF4 leukemias. Cancer Cell 14, 355–368. [PMC free article] [PubMed] [Google Scholar]
• Krivtsov AV, Hoshii T, and Armstrong SA (2017). Mixed-Lineage Leukemia Fusions and Chromatin in Leukemia. Cold Spring Harb Perspect Med 7. [PMC free article] [PubMed] [Google Scholar]
• Krivtsov AV, Twomey D, Feng Z, Stubbs MC, Wang Y, Faber J, Levine JE, Wang J, Hahn WC, Gilliland DG, et al. (2006). Transformation from committed progenitor to leukaemia stem cell initiated by MLL-AF9. Nature 442, 818–822. [PubMed] [Google Scholar]
• Kuhn MW, Song E, Feng Z, Sinha A, Chen CW, Deshpande AJ, Cusan M, Farnoud N, Mupo A, Grove C, et al. (2016). Targeting Chromatin Regulators Inhibits Leukemogenic Gene Expression in NPM1 Mutant Leukemia. Cancer Discov 6, 1166–1181. [PMC free article] [PubMed] [Google Scholar]
• Kumar AR, Li Q, Hudson WA, Chen W, Sam T, Yao Q, Lund EA, Wu B, Kowal BJ, and Kersey JH (2009). A role for MEIS1 in MLL-fusion gene leukemia. Blood 113, 1756–1758. [PMC free article] [PubMed] [Google Scholar]
• Langmead B, and Salzberg SL (2012). Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357–359. [PMC free article] [PubMed] [Google Scholar]
• Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, and Genome Project Data Processing, S. (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics (Oxford, England) 25, 2078–2079. [PMC free article] [PubMed] [Google Scholar]
• Liang K, Volk AG, Haug JS, Marshall SA, Woodfin AR, Bartom ET, Gilmore JM, Florens L, Washburn MP, Sullivan KD, et al. (2017). Therapeutic Targeting of MLL Degradation Pathways in MLL-Rearranged Leukemia. Cell 168, 59–72 e13. [PMC free article] [PubMed] [Google Scholar]
• Liao Y, Smyth GK, and Shi W (2014). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics (Oxford, England) 30, 923–930. [PubMed] [Google Scholar]
• Liem NLM, Papa RA, Milross CG, Schmid MA, Tajbakhsh M, Choi S, Ramirez D, Rice AM, Haber M, Norris MD, et al. (2004). Characterization of childhood acute lymphoblastic leukemia xenograft models for the preclinical evaluation of new therapies. Blood 103, 3905–3914. [PubMed] [Google Scholar]
• Liu Z, Lindblom P, Claremon DA, and Singh SB (2012). Chapter 11 Structure-based Design Technology CONTOUR and its Application to Drug Discovery In Innovations in Biomolecular Modeling and Simulations: Volume 2, (The Royal Society of Chemistry; ), pp. 265–280. [Google Scholar]
• Lock RB, Liem N, Farnsworth ML, Milross CG, Xue C, Tajbakhsh M, Haber M, Norris MD, Marshall GM, and Rice AM (2002). The nonobese diabetic/severe combined immunodeficient (NOD/SCID) mouse model of childhood acute lymphoblastic leukemia reveals intrinsic differences in biologic characteristics at diagnosis and relapse. Blood 99, 4100–4108. [PubMed] [Google Scholar]
• Love MI, Huber W, and Anders S (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology 15, 550. [PMC free article] [PubMed] [Google Scholar]
• Loven J, Hoke HA, Lin CY, Lau A, Orlando DA, Vakoc CR, Bradner JE, Lee TI, and Young RA (2013). Selective inhibition of tumor oncogenes by disruption of super-enhancers. Cell 153, 320–334. [PMC free article] [PubMed] [Google Scholar]
• Macaulay IC, Teng MJ, Haerty W, Kumar P, Ponting CP, and Voet T (2016). Separation and parallel sequencing of the genomes and transcriptomes of single cells using G&T-seq. Nat Protoc 11, 2081–2103. [PubMed] [Google Scholar]
• Marschalek R (2015). MLL leukemia and future treatment strategies. Arch Pharm (Weinheim) 348, 221–228. [PubMed] [Google Scholar]
• Meyer C, Burmeister T, Groger D, Tsaur G, Fechina L, Renneville A, Sutton R, Venn NC, Emerenciano M, Pombo-de-Oliveira MS, et al. (2018). The MLL recombinome of acute leukemias in 2017. Leukemia 32, 273–284. [PMC free article] [PubMed] [Google Scholar]
• Milne TA, Kim J, Wang GG, Stadler SC, Basrur V, Whitcomb SJ, Wang Z, Ruthenburg AJ, Elenitoba-Johnson KS, Roeder RG, and Allis CD (2010). Multiple interactions recruit MLL1 and MLL1 fusion proteins to the HOXA9 locus in leukemogenesis. Mol Cell 38, 853–863. [PMC free article] [PubMed] [Google Scholar]
• Milne TA, Martin ME, Brock HW, Slany RK, and Hess JL (2005). Leukemogenic MLL fusion proteins bind across a broad region of the Hox a9 locus, promoting transcription and multiple histone modifications. Cancer Res 65, 11367–11374. [PubMed] [Google Scholar]
• Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, Lehar J, Puigserver P, Carlsson E, Ridderstrale M, Laurila E, et al. (2003). PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet 34, 267–273. [PubMed] [Google Scholar]
• Ohyashiki K, Ohyashiki JH, and Sandberg AA (1986). Cytogenetic characterization of putative human myeloblastic leukemia cell lines (ML-1, -2, and -3): origin of the cells. Cancer Res 46, 3642–3647. [PubMed] [Google Scholar]
• Okada Y, Feng Q, Lin Y, Jiang Q, Li Y, Coffield VM, Su L, Xu G, and Zhang Y (2005). hDOT1L links histone methylation to leukemogenesis. Cell 121, 167–178. [PubMed] [Google Scholar]
• Okuda H, Stanojevic B, Kanai A, Kawamura T, Takahashi S, Matsui H, Takaori-Kondo A, and Yokoyama A (2017). Cooperative gene activation by AF4 and DOT1L drives MLL-rearranged leukemia. J Clin Invest 127, 1918–1931. [PMC free article] [PubMed] [Google Scholar]
• Orlovsky K, Kalinkovich A, Rozovskaia T, Shezen E, Itkin T, Alder H, Ozer HG, Carramusa L, Avigdor A, Volinia S, et al. (2011). Down-regulation of homeobox genes MEIS1 and HOXA in MLL-rearranged acute leukemia impairs engraftment and reduces proliferation. Proc Natl Acad Sci U S A 108, 7956–7961. [PMC free article] [PubMed] [Google Scholar]
• Picelli S, Faridani OR, Bjorklund AK, Winberg G, Sagasser S, and Sandberg R (2014). Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc 9, 171–181. [PubMed] [Google Scholar]
• Placke T, Faber K, Nonami A, Putwain SL, Salih HR, Heidel FH, Kramer A, Root DE, Barbie DA, Krivtsov AV, et al. (2014). Requirement for CDK6 in MLL-rearranged acute myeloid leukemia. Blood 124, 13–23. [PMC free article] [PubMed] [Google Scholar]
• Rani N, Aichem A, Schmidtke G, Kreft SG, and Groettrup M (2012). FAT10 and NUB1L bind to the VWA domain of Rpn10 and Rpn1 to enable proteasome-mediated proteolysis. Nat Commun 3, 749. [PubMed] [Google Scholar]
• Richmond J, Carol H, Evans K, High L, Mendomo A, Robbins A, Meyer C, Venn NC, Marschalek R, Henderson M, et al. (2015). Effective targeting of the P53-MDM2 axis in preclinical models of infant MLL-rearranged acute lymphoblastic leukemia. Clin Cancer Res 21, 1395–1405. [PMC free article] [PubMed] [Google Scholar]
• Robinson JT, Thorvaldsdottir H, Wenger AM, Zehir A, and Mesirov JP (2017). Variant Review with the Integrative Genomics Viewer. Cancer Res 77, e31–e34. [PMC free article] [PubMed] [Google Scholar]
• Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, and Mesirov JP (2011). Integrative genomics viewer. Nat Biotechnol 29, 24–26. [PMC free article] [PubMed] [Google Scholar]
• Robinson MD, McCarthy DJ, and Smyth GK (2010). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics (Oxford, England) 26, 139–140. [PMC free article] [PubMed] [Google Scholar]
• Shi A, Murai MJ, He S, Lund G, Hartley T, Purohit T, Reddy G, Chruszcz M, Grembecka J, and Cierpicki T (2012). Structural insights into inhibition of the bivalent menin-MLL interaction by small molecules in leukemia. Blood 120, 4461–4469. [PMC free article] [PubMed] [Google Scholar]
• Shin H, Liu T, Manrai AK, and Liu XS (2009). CEAS: cis-regulatory element annotation system. Bioinformatics (Oxford, England) 25, 2605–2606. [PubMed] [Google Scholar]
• Skene PJ, and Henikoff S (2017). An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites. Elife 6. [PMC free article] [PubMed] [Google Scholar]
• Slany RK (2009). The molecular biology of mixed lineage leukemia. Haematologica 94, 984–993. [PMC free article] [PubMed] [Google Scholar]
• Smith E, Lin C, and Shilatifard A (2011). The super elongation complex (SEC) and MLL in development and disease. Genes Dev 25, 661–672. [PMC free article] [PubMed] [Google Scholar]
• Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, and Mesirov JP (2005). Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102, 15545–15550. [PMC free article] [PubMed] [Google Scholar]
• Thorvaldsdottir H, Robinson JT, and Mesirov JP (2013). Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform 14, 178–192. [PMC free article] [PubMed] [Google Scholar]
• Townsend EC, Murakami MA, Christodoulou A, Christie AL, Koster J, DeSouza TA, Morgan EA, Kallgren SP, Liu H, Wu SC, et al. (2016). The Public Repository of Xenografts Enables Discovery and Randomized Phase II-like Trials in Mice. Cancer Cell 29, 574–586. [PMC free article] [PubMed] [Google Scholar]
• Wang QF, Wu G, Mi S, He F, Wu J, Dong J, Luo RT, Mattison R, Kaberlein JJ, Prabhakar S, et al. (2011). MLL fusion proteins preferentially regulate a subset of wild-type MLL target genes in the leukemic genome. Blood 117, 6895–6905. [PMC free article] [PubMed] [Google Scholar]
• Whyte WA, Orlando DA, Hnisz D, Abraham BJ, Lin CY, Kagey MH, Rahl PB, Lee TI, and Young RA (2013). Master transcription factors and mediator establish super-enhancers at key cell identity genes. Cell 153, 307–319. [PMC free article] [PubMed] [Google Scholar]
• Xu Y, Yue L, Wang Y, Xing J, Chen Z, Shi Z, Liu R, Liu YC, Luo X, Jiang H, et al. (2016). Discovery of Novel Inhibitors Targeting the Menin-Mixed Lineage Leukemia Interface Using Pharmacophore- and Docking-Based Virtual Screening. J Chem Inf Model 56, 1847–1855. [PubMed] [Google Scholar]
• Yokoyama A, and Cleary ML (2008). Menin critically links MLL proteins with LEDGF on cancer-associated target genes. Cancer Cell 14, 36–46. [PMC free article] [PubMed] [Google Scholar]
• Yokoyama A, Somervaille TC, Smith KS, Rozenblatt-Rosen O, Meyerson M, and Cleary ML (2005). The menin tumor suppressor protein is an essential oncogenic cofactor for MLL-associated leukemogenesis. Cell 123, 207–218. [PubMed] [Google Scholar]
• Zhu N, Chen M, Eng R, DeJong J, Sinha AU, Rahnamay NF, Koche R, Al-Shahrour F, Minehart JC, Chen CW, et al. (2016). MLL-AF9- and HOXA9-mediated acute myeloid leukemia stem cell self-renewal requires JMJD1C. J Clin Invest 126, 997–1011. [PMC free article] [PubMed] [Google Scholar]
• Zhu Q, Liu N, Orkin SH, and Yuan GC (2019). CUT&RUNTools: a flexible pipeline for CUT&RUN processing and footprint analysis. Genome biology 20, 192. [PMC free article] [PubMed] [Google Scholar]

Online Tools To Design Master Bathroom 10'5 W 11.4l

Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7227117/

Posted by: hallplover.blogspot.com

Share this post